Gene Page: GPC6
Summary ?
GeneID | 10082 |
Symbol | GPC6 |
Synonyms | OMIMD1 |
Description | glypican 6 |
Reference | MIM:604404|HGNC:HGNC:4454|Ensembl:ENSG00000183098|HPRD:05099|Vega:OTTHUMG00000017205 |
Gene type | protein-coding |
Map location | 13q32 |
Pascal p-value | 0.004 |
DMG | 1 (# studies) |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:GWAScat | Genome-wide Association Studies | This data set includes 560 SNPs associated with schizophrenia. A total of 486 genes were mapped to these SNPs within 50kb. | |
CV:GWASdb | Genome-wide Association Studies | GWASdb records for schizophrenia | |
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Nishioka_2013 | Genome-wide DNA methylation analysis | The authors investigated the methylation profiles of DNA in peripheral blood cells from 18 patients with first-episode schizophrenia (FESZ) and from 15 normal controls. | 1 |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg23246978 | 13 | 93879042 | GPC6 | -0.027 | 0.41 | DMG:Nishioka_2013 |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
THUMPD1 | 0.94 | 0.95 |
NFX1 | 0.94 | 0.94 |
TERF2 | 0.93 | 0.94 |
JAKMIP2 | 0.93 | 0.94 |
TP53BP1 | 0.93 | 0.94 |
ZNF134 | 0.93 | 0.94 |
ZNF623 | 0.93 | 0.95 |
ARIH1 | 0.93 | 0.94 |
HMG20A | 0.93 | 0.94 |
SRGAP2P2 | 0.93 | 0.94 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
AF347015.31 | -0.78 | -0.86 |
MT-CO2 | -0.77 | -0.86 |
FXYD1 | -0.77 | -0.86 |
AF347015.27 | -0.76 | -0.84 |
AF347015.33 | -0.75 | -0.82 |
AF347015.8 | -0.74 | -0.85 |
MT-CYB | -0.74 | -0.82 |
HIGD1B | -0.74 | -0.84 |
HSD17B14 | -0.74 | -0.79 |
IFI27 | -0.74 | -0.83 |
Section III. Gene Ontology annotation
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0005576 | extracellular region | IEA | - | |
GO:0005578 | proteinaceous extracellular matrix | IEA | - | |
GO:0005886 | plasma membrane | IEA | - | |
GO:0005887 | integral to plasma membrane | TAS | 10329016 | |
GO:0031225 | anchored to membrane | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
REACTOME HS GAG DEGRADATION | 20 | 15 | All SZGR 2.0 genes in this pathway |
REACTOME CHONDROITIN SULFATE DERMATAN SULFATE METABOLISM | 49 | 33 | All SZGR 2.0 genes in this pathway |
REACTOME HS GAG BIOSYNTHESIS | 31 | 17 | All SZGR 2.0 genes in this pathway |
REACTOME HEPARAN SULFATE HEPARIN HS GAG METABOLISM | 52 | 33 | All SZGR 2.0 genes in this pathway |
REACTOME GLYCOSAMINOGLYCAN METABOLISM | 111 | 69 | All SZGR 2.0 genes in this pathway |
REACTOME A TETRASACCHARIDE LINKER SEQUENCE IS REQUIRED FOR GAG SYNTHESIS | 25 | 17 | All SZGR 2.0 genes in this pathway |
REACTOME METABOLISM OF CARBOHYDRATES | 247 | 154 | All SZGR 2.0 genes in this pathway |
LIU PROSTATE CANCER DN | 481 | 290 | All SZGR 2.0 genes in this pathway |
CHEMNITZ RESPONSE TO PROSTAGLANDIN E2 DN | 391 | 222 | All SZGR 2.0 genes in this pathway |
VECCHI GASTRIC CANCER ADVANCED VS EARLY UP | 175 | 120 | All SZGR 2.0 genes in this pathway |
SABATES COLORECTAL ADENOMA DN | 291 | 176 | All SZGR 2.0 genes in this pathway |
GAUSSMANN MLL AF4 FUSION TARGETS D DN | 9 | 6 | All SZGR 2.0 genes in this pathway |
LINDGREN BLADDER CANCER CLUSTER 2B | 392 | 251 | All SZGR 2.0 genes in this pathway |
MOHANKUMAR TLX1 TARGETS DN | 193 | 112 | All SZGR 2.0 genes in this pathway |
SHETH LIVER CANCER VS TXNIP LOSS PAM1 | 229 | 137 | All SZGR 2.0 genes in this pathway |
BENPORATH NANOG TARGETS | 988 | 594 | All SZGR 2.0 genes in this pathway |
BENPORATH SOX2 TARGETS | 734 | 436 | All SZGR 2.0 genes in this pathway |
MEDINA SMARCA4 TARGETS | 44 | 29 | All SZGR 2.0 genes in this pathway |
CUI TCF21 TARGETS 2 UP | 428 | 266 | All SZGR 2.0 genes in this pathway |
KONDO EZH2 TARGETS | 245 | 148 | All SZGR 2.0 genes in this pathway |
RIGGI EWING SARCOMA PROGENITOR DN | 191 | 123 | All SZGR 2.0 genes in this pathway |
MOLENAAR TARGETS OF CCND1 AND CDK4 DN | 58 | 25 | All SZGR 2.0 genes in this pathway |
ACEVEDO LIVER CANCER WITH H3K27ME3 DN | 228 | 114 | All SZGR 2.0 genes in this pathway |
SHARMA PILOCYTIC ASTROCYTOMA LOCATION UP | 25 | 12 | All SZGR 2.0 genes in this pathway |
CHICAS RB1 TARGETS GROWING | 243 | 155 | All SZGR 2.0 genes in this pathway |
CHICAS RB1 TARGETS CONFLUENT | 567 | 365 | All SZGR 2.0 genes in this pathway |
PILON KLF1 TARGETS UP | 504 | 321 | All SZGR 2.0 genes in this pathway |
GOBERT OLIGODENDROCYTE DIFFERENTIATION UP | 570 | 339 | All SZGR 2.0 genes in this pathway |
IKEDA MIR133 TARGETS UP | 43 | 27 | All SZGR 2.0 genes in this pathway |
PLASARI TGFB1 SIGNALING VIA NFIC 1HR DN | 106 | 77 | All SZGR 2.0 genes in this pathway |
RAO BOUND BY SALL4 ISOFORM B | 517 | 302 | All SZGR 2.0 genes in this pathway |
NABA ECM AFFILIATED | 171 | 89 | All SZGR 2.0 genes in this pathway |
NABA MATRISOME ASSOCIATED | 753 | 411 | All SZGR 2.0 genes in this pathway |
NABA MATRISOME | 1028 | 559 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-103/107 | 289 | 296 | 1A,m8 | hsa-miR-103brain | AGCAGCAUUGUACAGGGCUAUGA |
hsa-miR-107brain | AGCAGCAUUGUACAGGGCUAUCA | ||||
miR-376 | 109 | 115 | m8 | hsa-miR-376a | AUCAUAGAGGAAAAUCCACGU |
hsa-miR-376b | AUCAUAGAGGAAAAUCCAUGUU | ||||
miR-431 | 396 | 402 | 1A | hsa-miR-431 | UGUCUUGCAGGCCGUCAUGCA |
miR-9 | 156 | 162 | 1A | hsa-miR-9SZ | UCUUUGGUUAUCUAGCUGUAUGA |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.