Gene Page: OLFM1
Summary ?
GeneID | 10439 |
Symbol | OLFM1 |
Synonyms | AMY|NOE1|NOELIN1|OlfA |
Description | olfactomedin 1 |
Reference | MIM:605366|HGNC:HGNC:17187|Ensembl:ENSG00000130558|HPRD:09249|Vega:OTTHUMG00000020897 |
Gene type | protein-coding |
Map location | 9q34.3 |
Pascal p-value | 0.424 |
Sherlock p-value | 0.756 |
DEG p-value | DEG:Maycox_2009:CC_BA10_fold_change=-1.16:CC_BA10_disease_P=0.0212:HBB_BA9_fold_change=-1.18:HBB_BA9_disease_P=0.0222 |
Fetal beta | -2.459 |
eGene | Myers' cis & trans |
Support | G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-FULL G2Cdb.human_BAYES-COLLINS-MOUSE-PSD-CONSENSUS G2Cdb.humanPSD G2Cdb.humanPSP CompositeSet Darnell FMRP targets |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DEG:Maycox_2009 | Microarray to determine the expression of over 30000 mRNA transcripts in post-mortem tissue | We included 51 genes whose expression changes are common between two schizophrenia cohorts. | |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 |
Section I. Genetics and epigenetics annotation
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs2809658 | chr1 | 43050395 | OLFM1 | 10439 | 0.1 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
HOXB2 | 0.95 | 0.07 |
IRX2 | 0.89 | 0.13 |
IRX1 | 0.73 | 0.13 |
WFIKKN2 | 0.57 | 0.04 |
NRP1 | 0.56 | 0.08 |
ROBO3 | 0.54 | 0.22 |
PRDM6 | 0.52 | 0.29 |
TMC5 | 0.40 | 0.28 |
RAB42 | 0.38 | 0.05 |
MXRA5 | 0.35 | 0.16 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
BAG1 | -0.07 | -0.08 |
ZNF771 | -0.07 | 0.12 |
LGI4 | -0.07 | 0.16 |
GDF1 | -0.07 | 0.05 |
C1orf151 | -0.07 | 0.21 |
LHPP | -0.07 | 0.26 |
ZNF444 | -0.07 | 0.04 |
MRPL41 | -0.07 | 0.15 |
DUSP28 | -0.07 | -0.03 |
WFIKKN1 | -0.06 | -0.01 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0005515 | protein binding | IPI | 17043677 | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0007399 | nervous system development | TAS | neurite (GO term level: 5) | 9039501 |
GO:0007275 | multicellular organismal development | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005788 | endoplasmic reticulum lumen | IEA | - | |
GO:0005783 | endoplasmic reticulum | IEA | - | |
GO:0016020 | membrane | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
ONKEN UVEAL MELANOMA UP | 783 | 507 | All SZGR 2.0 genes in this pathway |
SENESE HDAC3 TARGETS UP | 501 | 327 | All SZGR 2.0 genes in this pathway |
DODD NASOPHARYNGEAL CARCINOMA DN | 1375 | 806 | All SZGR 2.0 genes in this pathway |
GOZGIT ESR1 TARGETS DN | 781 | 465 | All SZGR 2.0 genes in this pathway |
COLDREN GEFITINIB RESISTANCE UP | 85 | 57 | All SZGR 2.0 genes in this pathway |
HAMAI APOPTOSIS VIA TRAIL UP | 584 | 356 | All SZGR 2.0 genes in this pathway |
WONG ENDMETRIUM CANCER DN | 82 | 53 | All SZGR 2.0 genes in this pathway |
MARTORIATI MDM4 TARGETS FETAL LIVER DN | 514 | 319 | All SZGR 2.0 genes in this pathway |
DAIRKEE TERT TARGETS DN | 124 | 79 | All SZGR 2.0 genes in this pathway |
HATADA METHYLATED IN LUNG CANCER UP | 390 | 236 | All SZGR 2.0 genes in this pathway |
WILLIAMS ESR1 TARGETS UP | 26 | 16 | All SZGR 2.0 genes in this pathway |
SCHAEFFER PROSTATE DEVELOPMENT 12HR DN | 57 | 45 | All SZGR 2.0 genes in this pathway |
SCHAEFFER SOX9 TARGETS IN PROSTATE DEVELOPMENT DN | 45 | 33 | All SZGR 2.0 genes in this pathway |
RICKMAN HEAD AND NECK CANCER A | 100 | 63 | All SZGR 2.0 genes in this pathway |
BENPORATH ES 1 | 379 | 235 | All SZGR 2.0 genes in this pathway |
STARK PREFRONTAL CORTEX 22Q11 DELETION UP | 195 | 138 | All SZGR 2.0 genes in this pathway |
POMEROY MEDULLOBLASTOMA DESMOPLASIC VS CLASSIC UP | 62 | 38 | All SZGR 2.0 genes in this pathway |
ZHANG TARGETS OF EWSR1 FLI1 FUSION | 88 | 68 | All SZGR 2.0 genes in this pathway |
YU MYC TARGETS DN | 55 | 38 | All SZGR 2.0 genes in this pathway |
STAEGE EWING FAMILY TUMOR | 33 | 22 | All SZGR 2.0 genes in this pathway |
KUMAR TARGETS OF MLL AF9 FUSION | 405 | 264 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 16HR UP | 225 | 139 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE DN | 1237 | 837 | All SZGR 2.0 genes in this pathway |
MCCLUNG DELTA FOSB TARGETS 2WK | 48 | 36 | All SZGR 2.0 genes in this pathway |
MCCLUNG CREB1 TARGETS UP | 100 | 72 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 12HR UP | 111 | 68 | All SZGR 2.0 genes in this pathway |
XU GH1 AUTOCRINE TARGETS DN | 142 | 94 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 24HR UP | 148 | 96 | All SZGR 2.0 genes in this pathway |
KRASNOSELSKAYA ILF3 TARGETS DN | 46 | 38 | All SZGR 2.0 genes in this pathway |
DOUGLAS BMI1 TARGETS UP | 566 | 371 | All SZGR 2.0 genes in this pathway |
CREIGHTON ENDOCRINE THERAPY RESISTANCE 1 | 528 | 324 | All SZGR 2.0 genes in this pathway |
CREIGHTON ENDOCRINE THERAPY RESISTANCE 4 | 307 | 185 | All SZGR 2.0 genes in this pathway |
STEIN ESRRA TARGETS RESPONSIVE TO ESTROGEN DN | 41 | 26 | All SZGR 2.0 genes in this pathway |
MASSARWEH TAMOXIFEN RESISTANCE DN | 258 | 160 | All SZGR 2.0 genes in this pathway |
MASSARWEH RESPONSE TO ESTRADIOL | 61 | 47 | All SZGR 2.0 genes in this pathway |
RIZKI TUMOR INVASIVENESS 3D DN | 270 | 181 | All SZGR 2.0 genes in this pathway |
HANN RESISTANCE TO BCL2 INHIBITOR UP | 36 | 24 | All SZGR 2.0 genes in this pathway |
BOYLAN MULTIPLE MYELOMA C D DN | 252 | 155 | All SZGR 2.0 genes in this pathway |
YOSHIMURA MAPK8 TARGETS UP | 1305 | 895 | All SZGR 2.0 genes in this pathway |
ZHANG TLX TARGETS 36HR UP | 221 | 150 | All SZGR 2.0 genes in this pathway |
ZHANG TLX TARGETS 60HR UP | 293 | 203 | All SZGR 2.0 genes in this pathway |
ZHANG TLX TARGETS UP | 108 | 78 | All SZGR 2.0 genes in this pathway |
CROONQUIST STROMAL STIMULATION UP | 60 | 42 | All SZGR 2.0 genes in this pathway |
MEISSNER NPC HCP WITH H3K4ME2 | 491 | 319 | All SZGR 2.0 genes in this pathway |
STEIN ESR1 TARGETS | 85 | 55 | All SZGR 2.0 genes in this pathway |
STEIN ESTROGEN RESPONSE NOT VIA ESRRA | 18 | 12 | All SZGR 2.0 genes in this pathway |
NAKAYAMA SOFT TISSUE TUMORS PCA1 DN | 74 | 47 | All SZGR 2.0 genes in this pathway |
YAO TEMPORAL RESPONSE TO PROGESTERONE CLUSTER 11 | 103 | 68 | All SZGR 2.0 genes in this pathway |
NIELSEN SYNOVIAL SARCOMA UP | 18 | 14 | All SZGR 2.0 genes in this pathway |
MARTENS TRETINOIN RESPONSE UP | 857 | 456 | All SZGR 2.0 genes in this pathway |
KIM ALL DISORDERS OLIGODENDROCYTE NUMBER CORR UP | 756 | 494 | All SZGR 2.0 genes in this pathway |
DUTERTRE ESTRADIOL RESPONSE 6HR UP | 229 | 149 | All SZGR 2.0 genes in this pathway |
PANGAS TUMOR SUPPRESSION BY SMAD1 AND SMAD5 DN | 157 | 106 | All SZGR 2.0 genes in this pathway |
ZWANG TRANSIENTLY UP BY 2ND EGF PULSE ONLY | 1725 | 838 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-132/212 | 298 | 304 | m8 | hsa-miR-212SZ | UAACAGUCUCCAGUCACGGCC |
hsa-miR-132brain | UAACAGUCUACAGCCAUGGUCG | ||||
miR-141/200a | 751 | 757 | m8 | hsa-miR-141 | UAACACUGUCUGGUAAAGAUGG |
hsa-miR-200a | UAACACUGUCUGGUAACGAUGU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.