Gene Page: CPLX1
Summary ?
GeneID | 10815 |
Symbol | CPLX1 |
Synonyms | CPX-I|CPX1 |
Description | complexin 1 |
Reference | MIM:605032|HGNC:HGNC:2309|Ensembl:ENSG00000168993|HPRD:09233|Vega:OTTHUMG00000160005 |
Gene type | protein-coding |
Map location | 4p16.3 |
Pascal p-value | 0.024 |
Sherlock p-value | 0.57 |
Fetal beta | -1.377 |
eGene | Cerebellar Hemisphere Myers' cis & trans |
Support | EXOCYTOSIS CompositeSet Darnell FMRP targets |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 3 |
Section I. Genetics and epigenetics annotation
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs621071 | chr1 | 182682810 | CPLX1 | 10815 | 0.16 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
![Not available](/SZGR/GeneImg/CPLX1_DE_GTEx.png)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
WDR35 | 0.89 | 0.92 |
COPB2 | 0.89 | 0.91 |
AQR | 0.89 | 0.93 |
C3orf63 | 0.88 | 0.91 |
FNDC3A | 0.88 | 0.90 |
RAD21 | 0.88 | 0.90 |
SSR1 | 0.88 | 0.91 |
C1orf9 | 0.88 | 0.92 |
ZZZ3 | 0.88 | 0.91 |
TRIP12 | 0.88 | 0.90 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
FXYD1 | -0.70 | -0.74 |
MT-CO2 | -0.70 | -0.78 |
AF347015.31 | -0.68 | -0.76 |
AF347015.21 | -0.68 | -0.76 |
AF347015.33 | -0.67 | -0.74 |
IFI27 | -0.67 | -0.73 |
AF347015.8 | -0.66 | -0.76 |
AF347015.27 | -0.66 | -0.73 |
MYL3 | -0.65 | -0.71 |
HIGD1B | -0.65 | -0.74 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0019905 | syntaxin binding | IEA | Synap (GO term level: 5) | - |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0007268 | synaptic transmission | TAS | neuron, Synap, Neurotransmitter (GO term level: 6) | 7553862 |
GO:0006836 | neurotransmitter transport | IEA | neuron, Neurotransmitter (GO term level: 5) | - |
GO:0006887 | exocytosis | TAS | 7553862 | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005737 | cytoplasm | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
HOOI ST7 TARGETS UP | 94 | 57 | All SZGR 2.0 genes in this pathway |
VECCHI GASTRIC CANCER EARLY UP | 430 | 232 | All SZGR 2.0 genes in this pathway |
LASTOWSKA NEUROBLASTOMA COPY NUMBER DN | 800 | 473 | All SZGR 2.0 genes in this pathway |
MCCLUNG CREB1 TARGETS UP | 100 | 72 | All SZGR 2.0 genes in this pathway |
JIANG AGING CEREBRAL CORTEX DN | 54 | 43 | All SZGR 2.0 genes in this pathway |
LEIN NEURON MARKERS | 69 | 45 | All SZGR 2.0 genes in this pathway |
MATZUK SPERMATOZOA | 114 | 77 | All SZGR 2.0 genes in this pathway |
LEE DOUBLE POLAR THYMOCYTE | 27 | 17 | All SZGR 2.0 genes in this pathway |
MEISSNER NPC HCP WITH H3K4ME2 AND H3K27ME3 | 349 | 234 | All SZGR 2.0 genes in this pathway |
MIKKELSEN NPC HCP WITH H3K27ME3 | 341 | 243 | All SZGR 2.0 genes in this pathway |
MIKKELSEN MEF HCP WITH H3K27ME3 | 590 | 403 | All SZGR 2.0 genes in this pathway |
SERVITJA ISLET HNF1A TARGETS UP | 163 | 111 | All SZGR 2.0 genes in this pathway |
FOSTER KDM1A TARGETS DN | 211 | 119 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-135 | 104 | 111 | 1A,m8 | hsa-miR-135a | UAUGGCUUUUUAUUCCUAUGUGA |
hsa-miR-135b | UAUGGCUUUUCAUUCCUAUGUG | ||||
hsa-miR-135a | UAUGGCUUUUUAUUCCUAUGUGA | ||||
hsa-miR-135b | UAUGGCUUUUCAUUCCUAUGUG | ||||
hsa-miR-135a | UAUGGCUUUUUAUUCCUAUGUGA | ||||
hsa-miR-135b | UAUGGCUUUUCAUUCCUAUGUG | ||||
miR-137 | 625 | 632 | 1A,m8 | hsa-miR-137 | UAUUGCUUAAGAAUACGCGUAG |
miR-505 | 989 | 995 | 1A | hsa-miR-505 | GUCAACACUUGCUGGUUUCCUC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.