SZGR2

Summary ?

GeneID	1460
Symbol	CSNK2B
Synonyms	CK2B\|CK2N\|CSK2B\|G5A
Description	casein kinase 2 beta
Reference	MIM:115441\|HGNC:HGNC:2460\|Ensembl:ENSG00000204435\|HPRD:00278\|Vega:OTTHUMG00000177888
Gene type	protein-coding
Map location	6p21.3
Pascal p-value	1E-12
Sherlock p-value	1.106E-6
eGene	Myers' cis & trans Meta
Support	INTRACELLULAR SIGNAL TRANSDUCTION

Gene in Data Sources

Gene set name	Method of gene set	Description
CV:PGCnp	Genome-wide Association Study	GWAS
GSMA_I	Genome scan meta-analysis	Psr: 0.033
Network	Shortest path distance of core genes in the Human protein-protein interaction network	Contribution to shortest path in PPI network: 0.4231

Section I. Genetics and epigenetics annotation

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	qvalue	eQTL type
rs4854166	chr2	3297005	CSNK2B	1460	0.15	trans
rs16836102	chr4	4716366	CSNK2B	1460	0.14	trans
rs16869851	chr4	20690056	CSNK2B	1460	0.19	trans
rs1578978	chr8	118196802	CSNK2B	1460	0.11	trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
APOE	0.91	0.96
AC011427.1	0.90	0.94
METRN	0.87	0.94
TLCD1	0.86	0.94
S100A16	0.85	0.92
HSD17B14	0.85	0.92
PLA2G5	0.84	0.93
AIFM3	0.84	0.90
RAMP1	0.83	0.92
IFI27	0.83	0.90

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
ZRANB1	-0.76	-0.84
ARIH2	-0.75	-0.83
UBP1	-0.75	-0.81
C6orf168	-0.75	-0.82
TERF2	-0.75	-0.86
PARG	-0.74	-0.79
RASA1	-0.74	-0.80
NFX1	-0.74	-0.85
RNASEN	-0.74	-0.87
HEATR5B	-0.74	-0.85

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0008605	protein kinase CK2 regulator activity	IEA		-
GO:0008605	protein kinase CK2 regulator activity	NAS		2666134
GO:0005515	protein binding	IEA		-
GO:0004674	protein serine/threonine kinase activity	TAS		1856204
GO:0019904	protein domain specific binding	IPI		11984006
GO:0016301	kinase activity	IEA		-
GO:0042802	identical protein binding	IPI		10094392
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0016055	Wnt receptor signaling pathway	IEA		-
GO:0007165	signal transduction	TAS		2513884
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005956	protein kinase CK2 complex	IEA		-
GO:0005956	protein kinase CK2 complex	NAS		2666134

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
APC	BTPS2 \| DP2 \| DP2.5 \| DP3 \| GS	adenomatous polyposis coli	Affinity Capture-Western	BioGRID	11972058
ARAF	A-RAF \| ARAF1 \| PKS2 \| RAFA1	v-raf murine sarcoma 3611 viral oncogene homolog	-	HPRD,BioGRID	9042965
ATF1	EWS-ATF1 \| FUS/ATF-1 \| TREB36	activating transcription factor 1	Reconstituted Complex	BioGRID	9685505
BRCA1	BRCAI \| BRCC1 \| IRIS \| PSCP \| RNF53	breast cancer 1, early onset	Reconstituted Complex Two-hybrid	BioGRID	10403822
BRCA1	BRCAI \| BRCC1 \| IRIS \| PSCP \| RNF53	breast cancer 1, early onset	BRCA1 is phosphorylated by Casein kinase 2 through a physical interaction with CSNK2B	BIND	10403822
BTF3	BETA-NAC \| BTF3a \| BTF3b \| NACB	basic transcription factor 3	-	HPRD,BioGRID	10094400
CD163	M130 \| MM130	CD163 molecule	-	HPRD,BioGRID	11298324
CDC25B	-	cell division cycle 25 homolog B (S. pombe)	-	HPRD	12527891
CDC34	E2-CDC34 \| UBC3 \| UBE2R1	cell division cycle 34 homolog (S. cerevisiae)	-	HPRD,BioGRID	11546811
CDKN1A	CAP20 \| CDKN1 \| CIP1 \| MDA-6 \| P21 \| SDI1 \| WAF1 \| p21CIP1	cyclin-dependent kinase inhibitor 1A (p21, Cip1)	-	HPRD,BioGRID	10679299
CSNK2A1	CK2A1 \| CKII	casein kinase 2, alpha 1 polypeptide	Interaction between CK2-beta subunit (PDB ID: 1JWH_D) and CK2-alpha subunit (PDB ID: 1JWH_A).	BIND	11092945 \|11574463
CSNK2A1	CK2A1 \| CKII	casein kinase 2, alpha 1 polypeptide	Interaction between CK2-beta subunit (PDB ID: 1JWH_C) and CK2-alpha subunit (PDB ID: 1JWH_B).	BIND	11092945 \|11574463
CSNK2A1	CK2A1 \| CKII	casein kinase 2, alpha 1 polypeptide	Interaction between CK2-beta subunit (PDB ID: 1JWH_D) and CK2-alpha subunit (PDB ID: 1JWH_B).	BIND	11092945 \|11574463
CSNK2A1	CK2A1 \| CKII	casein kinase 2, alpha 1 polypeptide	-	HPRD,BioGRID	9188720 \|9571630
CSNK2A1	CK2A1 \| CKII	casein kinase 2, alpha 1 polypeptide	Interaction between CK2-beta subunit (PDB ID: 1JWH_C) and CK2-alpha subunit (PDB ID: 1JWH_A).	BIND	11092945 \|11574463
CSNK2A1	CK2A1 \| CKII	casein kinase 2, alpha 1 polypeptide	CK2-alpha subunit interacts with CK2-beta subunit.	BIND	7768894
CSNK2A2	CK2A2 \| CSNK2A1 \| FLJ43934	casein kinase 2, alpha prime polypeptide	-	HPRD,BioGRID	9571630
CSNK2A2	CK2A2 \| CSNK2A1 \| FLJ43934	casein kinase 2, alpha prime polypeptide	CK2-alpha' subunit interacts with CK2-beta subunit.	BIND	7768894
CSNK2B	CK2B \| CK2N \| CSK2B \| G5A \| MGC138222 \| MGC138224	casein kinase 2, beta polypeptide	CK2-beta subunit interacts with another copy of itself.	BIND	7768894
CSNK2B	CK2B \| CK2N \| CSK2B \| G5A \| MGC138222 \| MGC138224	casein kinase 2, beta polypeptide	-	HPRD,BioGRID	9188720 \|9571630
CSNK2B	CK2B \| CK2N \| CSK2B \| G5A \| MGC138222 \| MGC138224	casein kinase 2, beta polypeptide	Interaction between CK2-beta subunit (PDB ID: 1JWH_D) and CK2-beta subunit (PDB ID: 1JWH_C).	BIND	11092945 \|11574463
EIF2S2	DKFZp686L18198 \| EIF2 \| EIF2B \| EIF2beta \| MGC8508	eukaryotic translation initiation factor 2, subunit 2 beta, 38kDa	EIF2beta interacts with CK2beta.	BIND	12901717
FAF1	CGI-03 \| FLJ37524 \| HFAF1s \| UBXD12 \| UBXN3A \| hFAF1	Fas (TNFRSF6) associated factor 1	-	HPRD,BioGRID	10094392 \|11378439 \|11713579
FGF1	AFGF \| ECGF \| ECGF-beta \| ECGFA \| ECGFB \| FGF-alpha \| FGFA \| GLIO703 \| HBGF1	fibroblast growth factor 1 (acidic)	-	HPRD,BioGRID	12145206
FGF2	BFGF \| FGFB \| HBGF-2	fibroblast growth factor 2 (basic)	Reconstituted Complex	BioGRID	12145206
FIBP	FGFIBP \| FIBP-1	fibroblast growth factor (acidic) intracellular binding protein	-	HPRD	12145206
GADD45GIP1	CKBBP2 \| CRIF1 \| MGC4667 \| MGC4758 \| PLINP-1 \| PRG6 \| Plinp1	growth arrest and DNA-damage-inducible, gamma interacting protein 1	-	HPRD,BioGRID	11710515
HNRNPA2B1	DKFZp779B0244 \| FLJ22720 \| HNRNPA2 \| HNRNPB1 \| HNRPA2 \| HNRPA2B1 \| HNRPB1 \| RNPA2 \| SNRPB1	heterogeneous nuclear ribonucleoprotein A2/B1	Reconstituted Complex	BioGRID	10381337
IRF1	IRF-1 \| MAR	interferon regulatory factor 1	CK2-beta interacts with IRF-1 promoter.	BIND	15893730
LYN	FLJ26625 \| JTK8	v-yes-1 Yamaguchi sarcoma viral related oncogene homolog	Two-hybrid	BioGRID	14667819
LYST	CHS \| CHS1	lysosomal trafficking regulator	-	HPRD,BioGRID	11984006
MAGEB2	DAM6 \| MAGE-XP-2 \| MGC26438	melanoma antigen family B, 2	Affinity Capture-MS	BioGRID	17353931
MAPK14	CSBP1 \| CSBP2 \| CSPB1 \| EXIP \| Mxi2 \| PRKM14 \| PRKM15 \| RK \| SAPK2A \| p38 \| p38ALPHA	mitogen-activated protein kinase 14	-	HPRD	10747897
MBD4	MED1	methyl-CpG binding domain protein 4	Two-hybrid	BioGRID	14667819
MCRS1	ICP22BP \| INO80Q \| MCRS2 \| MSP58 \| P78	microspherule protein 1	Affinity Capture-MS	BioGRID	17353931
NCF1	FLJ79451 \| NCF1A \| NOXO2 \| SH3PXD1A \| p47phox	neutrophil cytosolic factor 1	Two-hybrid	BioGRID	11485312
NCF1C	SH3PXD1C	neutrophil cytosolic factor 1C pseudogene	-	HPRD	11485312
NOLC1	KIAA0035 \| NOPP130 \| NOPP140 \| NS5ATP13 \| P130	nucleolar and coiled-body phosphoprotein 1	-	HPRD,BioGRID	9013635
PIN1	DOD \| UBL5	peptidylprolyl cis/trans isomerase, NIMA-interacting 1	-	HPRD	11940573
PRKCZ	PKC-ZETA \| PKC2	protein kinase C, zeta	-	HPRD,BioGRID	10764587
PRNP	ASCR \| CD230 \| CJD \| GSS \| MGC26679 \| PRIP \| PrP \| PrP27-30 \| PrP33-35C \| PrPc \| prion	prion protein	PrPc interacts with CSNK2B (CK2 beta) albeit weakly. This interaction was modeled on a demonstrated interaction between bovine PrPc and human CSNK2B (CK2 beta).	BIND	11062072
RNF7	CKBBP1 \| ROC2 \| SAG	ring finger protein 7	Reconstituted Complex Two-hybrid	BioGRID	11710515
RNPS1	E5.1 \| MGC117332	RNA binding protein S1, serine-rich domain	Affinity Capture-MS	BioGRID	17353931
RPL41	-	ribosomal protein L41	-	HPRD	11710515
RPL41	-	ribosomal protein L41	-	HPRD	9299532 \|11710515
RPL5	MGC117339 \| MSTP030	ribosomal protein L5	-	HPRD	8806611 \|9042965 \|9738462 \|10491318
RPL5	MGC117339 \| MSTP030	ribosomal protein L5	Two-hybrid	BioGRID	8806611 \|9042965 \|11710515 \|14667819
RPS6KB1	PS6K \| S6K \| S6K1 \| STK14A \| p70(S6K)-alpha \| p70-S6K \| p70-alpha	ribosomal protein S6 kinase, 70kDa, polypeptide 1	Affinity Capture-Western Reconstituted Complex	BioGRID	16895915
SHMT1	CSHMT \| MGC15229 \| MGC24556 \| SHMT	serine hydroxymethyltransferase 1 (soluble)	-	HPRD	10549165
SHMT2	GLYA \| SHMT	serine hydroxymethyltransferase 2 (mitochondrial)	-	HPRD	10549165
SNCAIP	MGC39814 \| SYPH1	synuclein, alpha interacting protein	CK2B interacts with Synphilin-1.	BIND	14645218
TERF2	TRBF2 \| TRF2	telomeric repeat binding factor 2	CK2-beta interacts with TAF7 promoter.	BIND	15893730
TOP2B	TOPIIB \| top2beta	topoisomerase (DNA) II beta 180kDa	-	HPRD,BioGRID	11710515
TP53	FLJ92943 \| LFS1 \| TRP53 \| p53	tumor protein p53	-	HPRD	10214938
ZNHIT1	CG1I \| ZNFN4A1	zinc finger, HIT type 1	-	HPRD	14667819

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG WNT SIGNALING PATHWAY	151	112	All SZGR 2.0 genes in this pathway
KEGG ADHERENS JUNCTION	75	53	All SZGR 2.0 genes in this pathway
KEGG TIGHT JUNCTION	134	86	All SZGR 2.0 genes in this pathway
PID NFKAPPAB ATYPICAL PATHWAY	17	15	All SZGR 2.0 genes in this pathway
PID DNA PK PATHWAY	16	10	All SZGR 2.0 genes in this pathway
PID ECADHERIN NASCENT AJ PATHWAY	39	33	All SZGR 2.0 genes in this pathway
PID ALK1 PATHWAY	26	21	All SZGR 2.0 genes in this pathway
PID P38 ALPHA BETA DOWNSTREAM PATHWAY	38	29	All SZGR 2.0 genes in this pathway
REACTOME DEVELOPMENTAL BIOLOGY	396	292	All SZGR 2.0 genes in this pathway
REACTOME AXON GUIDANCE	251	188	All SZGR 2.0 genes in this pathway
REACTOME L1CAM INTERACTIONS	86	62	All SZGR 2.0 genes in this pathway
REACTOME SIGNAL TRANSDUCTION BY L1	34	25	All SZGR 2.0 genes in this pathway
GINESTIER BREAST CANCER ZNF217 AMPLIFIED DN	335	193	All SZGR 2.0 genes in this pathway
GINESTIER BREAST CANCER 20Q13 AMPLIFICATION DN	180	101	All SZGR 2.0 genes in this pathway
RHEIN ALL GLUCOCORTICOID THERAPY DN	362	238	All SZGR 2.0 genes in this pathway
ENK UV RESPONSE KERATINOCYTE UP	530	342	All SZGR 2.0 genes in this pathway
OUELLET OVARIAN CANCER INVASIVE VS LMP UP	117	85	All SZGR 2.0 genes in this pathway
BARIS THYROID CANCER DN	59	45	All SZGR 2.0 genes in this pathway
GRASEMANN RETINOBLASTOMA WITH 6P AMPLIFICATION	14	14	All SZGR 2.0 genes in this pathway
SCHLOSSER SERUM RESPONSE AUGMENTED BY MYC	108	74	All SZGR 2.0 genes in this pathway
PATIL LIVER CANCER	747	453	All SZGR 2.0 genes in this pathway
DEN INTERACT WITH LCA5	26	21	All SZGR 2.0 genes in this pathway
PENG RAPAMYCIN RESPONSE DN	245	154	All SZGR 2.0 genes in this pathway
ZHAN MULTIPLE MYELOMA SUBGROUPS	30	20	All SZGR 2.0 genes in this pathway
SESTO RESPONSE TO UV C1	72	45	All SZGR 2.0 genes in this pathway
CHENG RESPONSE TO NICKEL ACETATE	45	29	All SZGR 2.0 genes in this pathway
MARSON BOUND BY E2F4 UNSTIMULATED	728	415	All SZGR 2.0 genes in this pathway
HSIAO HOUSEKEEPING GENES	389	245	All SZGR 2.0 genes in this pathway
CAIRO HEPATOBLASTOMA CLASSES UP	605	377	All SZGR 2.0 genes in this pathway
YAO TEMPORAL RESPONSE TO PROGESTERONE CLUSTER 17	181	101	All SZGR 2.0 genes in this pathway
KIM ALL DISORDERS OLIGODENDROCYTE NUMBER CORR UP	756	494	All SZGR 2.0 genes in this pathway
KIM BIPOLAR DISORDER OLIGODENDROCYTE DENSITY CORR UP	682	440	All SZGR 2.0 genes in this pathway
HIRSCH CELLULAR TRANSFORMATION SIGNATURE UP	242	159	All SZGR 2.0 genes in this pathway
JOHNSTONE PARVB TARGETS 3 DN	918	550	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-378	58	64	1A	hsa-miR-378	CUCCUGACUCCAGGUCCUGUGU

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: CSNK2B