SZGR2

Summary ?

GeneID	3356
Symbol	HTR2A
Synonyms	5-HT2A\|HTR2
Description	5-hydroxytryptamine receptor 2A
Reference	MIM:182135\|HGNC:HGNC:5293\|Ensembl:ENSG00000102468\|HPRD:01638\|Vega:OTTHUMG00000016881
Gene type	protein-coding
Map location	13q14-q21
Pascal p-value	0.54
Sherlock p-value	0.535
TADA p-value	0.01
Fetal beta	-2.971
Support	GPCR SIGNALLING CompositeSet

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
ADT:Sun_2012	Systematic Investigation of Antipsychotic Drugs and Their Targets	A total of 382 drug-target associations involving 43 antipsychotic drugs and 49 target genes.
CV:PGCnp	Genome-wide Association Study	GWAS
DNM:Fromer_2014	Whole Exome Sequencing analysis	This study reported a WES study of 623 schizophrenia trios, reporting DNMs using genomic DNA.
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Association	A combined odds ratio method (Sun et al. 2008), association studies	3	Link to SZGene
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenics,schizophrenias,schizotypal	Click to show details
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 3
Network	Shortest path distance of core genes in the Human protein-protein interaction network	Contribution to shortest path in PPI network: 31

Section I. Genetics and epigenetics annotation

DNM table

Gene	Chromosome	Position	Ref	Alt	Transcript	AA change	Mutation type	Sift	CG46	Trait	Study
HTR2A	chr13	47409765	A	C	NM_000621 NM_001165947	p.208M>R p.124M>R	missense missense			Schizophrenia	DNM:Fromer_2014

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
LRPPRC	0.94	0.95
ELP3	0.93	0.92
NPEPPS	0.93	0.93
EIF2AK1	0.93	0.95
KIAA1012	0.93	0.93
PPME1	0.93	0.92
ARMC8	0.93	0.93
KPNA4	0.93	0.94
RBBP5	0.93	0.93
CUL2	0.93	0.92

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
AF347015.31	-0.78	-0.77
MT-CO2	-0.77	-0.77
AF347015.8	-0.76	-0.76
AF347015.21	-0.75	-0.75
AF347015.2	-0.75	-0.74
AF347015.33	-0.74	-0.74
HIGD1B	-0.74	-0.75
MT-CYB	-0.74	-0.74
FXYD1	-0.74	-0.76
AF347015.27	-0.73	-0.74

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0004993	serotonin receptor activity	TAS	serotonin, Neurotransmitter (GO term level: 8)	9109547
GO:0004872	receptor activity	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0007268	synaptic transmission	TAS	neuron, Synap, Neurotransmitter (GO term level: 6)	9109547
GO:0007210	serotonin receptor signaling pathway	TAS	serotonin (GO term level: 8)	9109547
GO:0007165	signal transduction	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005886	plasma membrane	IEA		-
GO:0005887	integral to plasma membrane	TAS		9109547

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG CALCIUM SIGNALING PATHWAY	178	134	All SZGR 2.0 genes in this pathway
KEGG NEUROACTIVE LIGAND RECEPTOR INTERACTION	272	195	All SZGR 2.0 genes in this pathway
KEGG GAP JUNCTION	90	68	All SZGR 2.0 genes in this pathway
REACTOME GASTRIN CREB SIGNALLING PATHWAY VIA PKC AND MAPK	205	136	All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY GPCR	920	449	All SZGR 2.0 genes in this pathway
REACTOME CLASS A1 RHODOPSIN LIKE RECEPTORS	305	177	All SZGR 2.0 genes in this pathway
REACTOME AMINE LIGAND BINDING RECEPTORS	38	33	All SZGR 2.0 genes in this pathway
REACTOME SEROTONIN RECEPTORS	12	11	All SZGR 2.0 genes in this pathway
REACTOME G ALPHA Q SIGNALLING EVENTS	184	116	All SZGR 2.0 genes in this pathway
REACTOME GPCR DOWNSTREAM SIGNALING	805	368	All SZGR 2.0 genes in this pathway
REACTOME GPCR LIGAND BINDING	408	246	All SZGR 2.0 genes in this pathway
DIERICK SEROTONIN FUNCTION GENES	6	6	All SZGR 2.0 genes in this pathway
PUJANA BRCA1 PCC NETWORK	1652	1023	All SZGR 2.0 genes in this pathway
PUJANA ATM PCC NETWORK	1442	892	All SZGR 2.0 genes in this pathway
LU AGING BRAIN DN	153	120	All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE DN	1237	837	All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS UP	1305	895	All SZGR 2.0 genes in this pathway
MIKKELSEN MCV6 ICP WITH H3K4ME3 AND H3K27ME3	34	21	All SZGR 2.0 genes in this pathway
KIM ALL DISORDERS CALB1 CORR UP	548	370	All SZGR 2.0 genes in this pathway
FIGUEROA AML METHYLATION CLUSTER 1 UP	125	61	All SZGR 2.0 genes in this pathway
WANG MLL TARGETS	289	188	All SZGR 2.0 genes in this pathway
BRIDEAU IMPRINTED GENES	63	47	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-103/107	616	622	1A	hsa-miR-103^brain	AGCAGCAUUGUACAGGGCUAUGA
miR-103/107	616	622	1A	hsa-miR-107^brain	AGCAGCAUUGUACAGGGCUAUCA
miR-26	544	550	m8	hsa-miR-26a^brain	UUCAAGUAAUCCAGGAUAGGC
miR-26	544	550	m8	hsa-miR-26b^SZ	UUCAAGUAAUUCAGGAUAGGUU

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: HTR2A