Gene Page: MTHFR
Summary ?
| GeneID | 4524 |
| Symbol | MTHFR |
| Synonyms | - |
| Description | methylenetetrahydrofolate reductase (NAD(P)H) |
| Reference | MIM:607093|HGNC:HGNC:7436|Ensembl:ENSG00000177000|HPRD:06158|Vega:OTTHUMG00000002277 |
| Gene type | protein-coding |
| Map location | 1p36.3 |
| Pascal p-value | 0.084 |
| Fetal beta | 0.526 |
| eGene | Meta |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:GWASdb | Genome-wide Association Studies | GWASdb records for schizophrenia | |
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
| Association | A combined odds ratio method (Sun et al. 2008), association studies | 3 | Link to SZGene |
| Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenics,schizophrenias,schizotypal | Click to show details |
| GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 3 | |
| Network | Shortest path distance of core genes in the Human protein-protein interaction network | Contribution to shortest path in PPI network: 31 |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0004489 | methylenetetrahydrofolate reductase (NADPH) activity | EXP | glutamate (GO term level: 6) | 7726158 |
| GO:0004489 | methylenetetrahydrofolate reductase (NADPH) activity | IEA | glutamate (GO term level: 6) | - |
| GO:0004489 | methylenetetrahydrofolate reductase (NADPH) activity | TAS | glutamate (GO term level: 6) | 7647779 |
| GO:0005515 | protein binding | IPI | 15231747 | |
| GO:0016491 | oxidoreductase activity | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0009086 | methionine biosynthetic process | IEA | - | |
| GO:0006520 | amino acid metabolic process | TAS | 7647779 | |
| GO:0008015 | blood circulation | TAS | 7647779 | |
| GO:0055114 | oxidation reduction | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005829 | cytosol | EXP | 7726158 |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| KEGG ONE CARBON POOL BY FOLATE | 17 | 12 | All SZGR 2.0 genes in this pathway |
| REACTOME METABOLISM OF VITAMINS AND COFACTORS | 51 | 36 | All SZGR 2.0 genes in this pathway |
| GRAESSMANN APOPTOSIS BY DOXORUBICIN UP | 1142 | 669 | All SZGR 2.0 genes in this pathway |
| GRAESSMANN RESPONSE TO MC AND DOXORUBICIN UP | 612 | 367 | All SZGR 2.0 genes in this pathway |
| LASTOWSKA NEUROBLASTOMA COPY NUMBER DN | 800 | 473 | All SZGR 2.0 genes in this pathway |
| BENPORATH MYC TARGETS WITH EBOX | 230 | 156 | All SZGR 2.0 genes in this pathway |
| CREIGHTON ENDOCRINE THERAPY RESISTANCE 3 | 720 | 440 | All SZGR 2.0 genes in this pathway |
| STEARMAN LUNG CANCER EARLY VS LATE UP | 125 | 89 | All SZGR 2.0 genes in this pathway |
| MATZUK SPERMATOZOA | 114 | 77 | All SZGR 2.0 genes in this pathway |
| YOSHIMURA MAPK8 TARGETS UP | 1305 | 895 | All SZGR 2.0 genes in this pathway |
| DANG BOUND BY MYC | 1103 | 714 | All SZGR 2.0 genes in this pathway |
| MIKKELSEN ES ICP WITH H3K4ME3 | 718 | 401 | All SZGR 2.0 genes in this pathway |
| KOINUMA TARGETS OF SMAD2 OR SMAD3 | 824 | 528 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-22 | 132 | 139 | 1A,m8 | hsa-miR-22brain | AAGCUGCCAGUUGAAGAACUGU |
| miR-24 | 1957 | 1964 | 1A,m8 | hsa-miR-24SZ | UGGCUCAGUUCAGCAGGAACAG |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.