Gene Page: BCORL1
Summary ?
| GeneID | 63035 |
| Symbol | BCORL1 |
| Synonyms | BCoR-L1|CXorf10 |
| Description | BCL6 corepressor-like 1 |
| Reference | MIM:300688|HGNC:HGNC:25657|Ensembl:ENSG00000085185|HPRD:06517|Vega:OTTHUMG00000022379 |
| Gene type | protein-coding |
| Map location | Xq25-q26.1 |
| Sherlock p-value | 0.092 |
| Fetal beta | 1.042 |
| eGene | Myers' cis & trans |
| Support | CompositeSet |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| DNM:Xu_2012 | Whole Exome Sequencing analysis | De novo mutations of 4 genes were identified by exome sequencing of 795 samples in this study | |
| Expression | Meta-analysis of gene expression | P value: 1.914 |
Section I. Genetics and epigenetics annotation
DNM table
| Gene | Chromosome | Position | Ref | Alt | Transcript | AA change | Mutation type | Sift | CG46 | Trait | Study |
|---|---|---|---|---|---|---|---|---|---|---|---|
| BCORL1 | chrX | 129147913 | A | T | NM_021946 | p.389I>F | missense | Schizophrenia | DNM:Xu_2012 |
eQTL annotation
| SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
|---|---|---|---|---|---|---|---|---|
| rs16829545 | chr2 | 151977407 | BCORL1 | 63035 | 0.15 | trans | ||
| rs7584986 | chr2 | 184111432 | BCORL1 | 63035 | 0.09 | trans | ||
| rs3779491 | chr7 | 95120635 | BCORL1 | 63035 | 0.09 | trans | ||
| rs16955618 | chr15 | 29937543 | BCORL1 | 63035 | 0.01 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0006355 | regulation of transcription, DNA-dependent | IEA | - | |
| GO:0006350 | transcription | IEA | - | |
| GO:0016568 | chromatin modification | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005634 | nucleus | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| DEURIG T CELL PROLYMPHOCYTIC LEUKEMIA UP | 368 | 234 | All SZGR 2.0 genes in this pathway |
| ODONNELL METASTASIS UP | 82 | 58 | All SZGR 2.0 genes in this pathway |
| LIAO METASTASIS | 539 | 324 | All SZGR 2.0 genes in this pathway |
| GEORGES TARGETS OF MIR192 AND MIR215 | 893 | 528 | All SZGR 2.0 genes in this pathway |
| MEISSNER NPC HCP WITH H3K4ME2 | 491 | 319 | All SZGR 2.0 genes in this pathway |
| WAKABAYASHI ADIPOGENESIS PPARG BOUND 8D | 658 | 397 | All SZGR 2.0 genes in this pathway |
| ZWANG TRANSIENTLY UP BY 2ND EGF PULSE ONLY | 1725 | 838 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-128 | 495 | 502 | 1A,m8 | hsa-miR-128a | UCACAGUGAACCGGUCUCUUUU |
| hsa-miR-128b | UCACAGUGAACCGGUCUCUUUC | ||||
| miR-133 | 107 | 113 | 1A | hsa-miR-133a | UUGGUCCCCUUCAACCAGCUGU |
| hsa-miR-133b | UUGGUCCCCUUCAACCAGCUA | ||||
| miR-143 | 184 | 190 | m8 | hsa-miR-143brain | UGAGAUGAAGCACUGUAGCUCA |
| miR-146 | 179 | 186 | 1A,m8 | hsa-miR-146a | UGAGAACUGAAUUCCAUGGGUU |
| hsa-miR-146bbrain | UGAGAACUGAAUUCCAUAGGCU | ||||
| miR-155 | 137 | 143 | m8 | hsa-miR-155 | UUAAUGCUAAUCGUGAUAGGGG |
| miR-27 | 496 | 502 | m8 | hsa-miR-27abrain | UUCACAGUGGCUAAGUUCCGC |
| hsa-miR-27bbrain | UUCACAGUGGCUAAGUUCUGC | ||||
| miR-29 | 715 | 721 | m8 | hsa-miR-29aSZ | UAGCACCAUCUGAAAUCGGUU |
| hsa-miR-29bSZ | UAGCACCAUUUGAAAUCAGUGUU | ||||
| hsa-miR-29cSZ | UAGCACCAUUUGAAAUCGGU | ||||
| hsa-miR-29aSZ | UAGCACCAUCUGAAAUCGGUU | ||||
| hsa-miR-29bSZ | UAGCACCAUUUGAAAUCAGUGUU | ||||
| hsa-miR-29cSZ | UAGCACCAUUUGAAAUCGGU | ||||
| miR-382 | 512 | 518 | m8 | hsa-miR-382brain | GAAGUUGUUCGUGGUGGAUUCG |
| miR-423 | 72 | 79 | 1A,m8 | hsa-miR-423 | AGCUCGGUCUGAGGCCCCUCAG |
| miR-486 | 1452 | 1458 | m8 | hsa-miR-486 | UCCUGUACUGAGCUGCCCCGAG |
| miR-544 | 86 | 92 | m8 | hsa-miR-544 | AUUCUGCAUUUUUAGCAAGU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.