Gene Page: LDLRAD4
Summary ?
GeneID | 753 |
Symbol | LDLRAD4 |
Synonyms | C18orf1 |
Description | low density lipoprotein receptor class A domain containing 4 |
Reference | MIM:606571|HGNC:HGNC:1224|Ensembl:ENSG00000168675|HPRD:07358|Vega:OTTHUMG00000181925 |
Gene type | protein-coding |
Map location | 18p11.21 |
Pascal p-value | 0.263 |
eGene | Cerebellum |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DNM:Gulsuner_2013 | Whole Exome Sequencing analysis | 155 DNMs identified by exome sequencing of quads or trios of schizophrenia individuals and their parents. |
Section I. Genetics and epigenetics annotation
DNM table
Gene | Chromosome | Position | Ref | Alt | Transcript | AA change | Mutation type | Sift | CG46 | Trait | Study |
---|---|---|---|---|---|---|---|---|---|---|---|
LDLRAD4 | chr18 | 13438266 | G | A | NM_181482 | p.22G>S | missense | Schizophrenia | DNM:Gulsuner_2013 |
Section II. Transcriptome annotation
General gene expression (GTEx)
![Not available](/SZGR/GeneImg/LDLRAD4_DE_GTEx.png)
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
DNAJB9 | 0.78 | 0.85 |
SCOC | 0.75 | 0.85 |
IMPA1 | 0.75 | 0.82 |
IFT57 | 0.75 | 0.74 |
ARL1 | 0.72 | 0.83 |
NDUFAF4 | 0.70 | 0.78 |
COX11 | 0.70 | 0.79 |
MCF2 | 0.70 | 0.71 |
RAB4A | 0.70 | 0.71 |
STXBP6 | 0.69 | 0.61 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
SMTN | -0.39 | -0.45 |
ZNF814 | -0.35 | -0.48 |
AC010618.2 | -0.34 | -0.39 |
AC069281.3 | -0.34 | -0.47 |
WDR86 | -0.34 | -0.30 |
RP11-274B21.1 | -0.34 | -0.42 |
CRIPAK | -0.33 | -0.36 |
LIME1 | -0.33 | -0.35 |
AL008718.1 | -0.33 | -0.31 |
CLCF1 | -0.33 | -0.42 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0003674 | molecular_function | ND | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0008150 | biological_process | ND | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0016021 | integral to membrane | NAS | 9479497 | |
GO:0005886 | plasma membrane | IEA | - |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-130/301 | 579 | 586 | 1A,m8 | hsa-miR-130abrain | CAGUGCAAUGUUAAAAGGGCAU |
hsa-miR-301 | CAGUGCAAUAGUAUUGUCAAAGC | ||||
hsa-miR-130bbrain | CAGUGCAAUGAUGAAAGGGCAU | ||||
hsa-miR-454-3p | UAGUGCAAUAUUGCUUAUAGGGUUU | ||||
miR-153 | 1052 | 1058 | 1A | hsa-miR-153 | UUGCAUAGUCACAAAAGUGA |
miR-218 | 7064 | 7070 | 1A | hsa-miR-218brain | UUGUGCUUGAUCUAACCAUGU |
miR-25/32/92/363/367 | 6969 | 6975 | 1A | hsa-miR-25brain | CAUUGCACUUGUCUCGGUCUGA |
hsa-miR-32 | UAUUGCACAUUACUAAGUUGC | ||||
hsa-miR-92 | UAUUGCACUUGUCCCGGCCUG | ||||
hsa-miR-367 | AAUUGCACUUUAGCAAUGGUGA | ||||
hsa-miR-92bSZ | UAUUGCACUCGUCCCGGCCUC | ||||
hsa-miR-25brain | CAUUGCACUUGUCUCGGUCUGA | ||||
hsa-miR-32 | UAUUGCACAUUACUAAGUUGC | ||||
hsa-miR-92 | UAUUGCACUUGUCCCGGCCUG | ||||
hsa-miR-367 | AAUUGCACUUUAGCAAUGGUGA | ||||
hsa-miR-92bSZ | UAUUGCACUCGUCCCGGCCUC | ||||
miR-369-3p | 402 | 408 | 1A | hsa-miR-369-3p | AAUAAUACAUGGUUGAUCUUU |
miR-374 | 402 | 408 | m8 | hsa-miR-374 | UUAUAAUACAACCUGAUAAGUG |
miR-410 | 404 | 410 | 1A | hsa-miR-410 | AAUAUAACACAGAUGGCCUGU |
miR-448 | 1052 | 1058 | 1A | hsa-miR-448 | UUGCAUAUGUAGGAUGUCCCAU |
miR-96 | 505 | 511 | m8 | hsa-miR-96brain | UUUGGCACUAGCACAUUUUUGC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.