Gene Page: CDH2
Summary ?
GeneID | 1000 |
Symbol | CDH2 |
Synonyms | CD325|CDHN|CDw325|NCAD |
Description | cadherin 2 |
Reference | MIM:114020|HGNC:HGNC:1759|Ensembl:ENSG00000170558|HPRD:00226|Vega:OTTHUMG00000059940 |
Gene type | protein-coding |
Map location | 18q11.2 |
Pascal p-value | 0.97 |
Sherlock p-value | 0.539 |
Fetal beta | 0.8 |
DMG | 1 (# studies) |
eGene | Meta |
Support | CELL ADHESION AND TRANSSYNAPTIC SIGNALING G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-CONSENSUS G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-FULL G2Cdb.human_BAYES-COLLINS-MOUSE-PSD-CONSENSUS G2Cdb.humanNRC CompositeSet Ascano FMRP targets Potential synaptic genes |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:GWASdb | Genome-wide Association Studies | GWASdb records for schizophrenia | |
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Jaffe_2016 | Genome-wide DNA methylation analysis | This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. | 1 |
Network | Shortest path distance of core genes in the Human protein-protein interaction network | Contribution to shortest path in PPI network: 0.3081 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg15698842 | 18 | 25755641 | CDH2 | 3.92E-8 | -0.023 | 1.11E-5 | DMG:Jaffe_2016 |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
CNTNAP2 | 0.68 | 0.83 |
RAB3C | 0.67 | 0.82 |
GPR137C | 0.65 | 0.67 |
PGM2L1 | 0.63 | 0.69 |
YAF2 | 0.62 | 0.70 |
TCERG1L | 0.62 | 0.72 |
EMID2 | 0.62 | 0.67 |
TBC1D9 | 0.62 | 0.73 |
RASGEF1B | 0.62 | 0.65 |
PLEKHB2 | 0.62 | 0.81 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
GPRC5C | -0.37 | -0.43 |
EFEMP2 | -0.36 | -0.42 |
EIF4EBP3 | -0.35 | -0.38 |
AQP5 | -0.34 | -0.38 |
FXYD1 | -0.33 | -0.30 |
MT-CO2 | -0.32 | -0.35 |
ROM1 | -0.32 | -0.30 |
AF347015.2 | -0.32 | -0.30 |
AF347015.26 | -0.32 | -0.29 |
AF347015.31 | -0.32 | -0.33 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0005509 | calcium ion binding | IEA | - | |
GO:0005515 | protein binding | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0007155 | cell adhesion | TAS | 2384753 | |
GO:0007156 | homophilic cell adhesion | IEA | - | |
GO:0016339 | calcium-dependent cell-cell adhesion | IEA | - | |
GO:0016477 | cell migration | IEA | - | |
GO:0048514 | blood vessel morphogenesis | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0045202 | synapse | IEA | neuron, Synap, Neurotransmitter, Glial (GO term level: 2) | - |
GO:0016021 | integral to membrane | IEA | - | |
GO:0030027 | lamellipodium | IEA | - | |
GO:0005912 | adherens junction | IEA | - | |
GO:0005886 | plasma membrane | IEA | - |
Section IV. Protein-protein interaction annotation
Interactors | Aliases B | Official full name B | Experimental | Source | PubMed ID |
---|---|---|---|---|---|
ACTA1 | ACTA | ASMA | CFTD | CFTD1 | CFTDM | MPFD | NEM1 | NEM2 | NEM3 | actin, alpha 1, skeletal muscle | Affinity Capture-Western | BioGRID | 12438242 |
ARVCF | FLJ35345 | armadillo repeat gene deletes in velocardiofacial syndrome | - | HPRD | 11058098 |
BOC | - | Boc homolog (mouse) | - | HPRD,BioGRID | 12634428 |
CDH11 | CAD11 | CDHOB | OB | OSF-4 | cadherin 11, type 2, OB-cadherin (osteoblast) | - | HPRD,BioGRID | 14625392 |
CDH4 | CAD4 | FLJ22202 | FLJ40547 | MGC126700 | MGC138355 | RCAD | cadherin 4, type 1, R-cadherin (retinal) | - | HPRD,BioGRID | 10662782 |
CDON | CDO | MGC111524 | ORCAM | Cdon homolog (mouse) | - | HPRD,BioGRID | 12634428 |
CTNNA1 | CAP102 | FLJ36832 | catenin (cadherin-associated protein), alpha 1, 102kDa | Affinity Capture-MS Affinity Capture-Western | BioGRID | 12604612 |14625392 |
CTNNB1 | CTNNB | DKFZp686D02253 | FLJ25606 | FLJ37923 | catenin (cadherin-associated protein), beta 1, 88kDa | Affinity Capture-MS Affinity Capture-Western | BioGRID | 12604612 |14625392 |
CTNNB1 | CTNNB | DKFZp686D02253 | FLJ25606 | FLJ37923 | catenin (cadherin-associated protein), beta 1, 88kDa | - | HPRD | 12151522 |
CTNND1 | CAS | CTNND | KIAA0384 | P120CAS | P120CTN | p120 | catenin (cadherin-associated protein), delta 1 | Affinity Capture-MS Affinity Capture-Western | BioGRID | 12604612 |14625392 |
GNA12 | MGC104623 | MGC99644 | NNX3 | RMP | gep | guanine nucleotide binding protein (G protein) alpha 12 | - | HPRD,BioGRID | 11136230 |
GNA13 | G13 | MGC46138 | guanine nucleotide binding protein (G protein), alpha 13 | - | HPRD,BioGRID | 11136230 |
GRIK2 | EAA4 | GLR6 | GLUK6 | GLUR6 | MGC74427 | MRT6 | glutamate receptor, ionotropic, kainate 2 | - | HPRD | 12151522 |
GRIN1 | NMDA1 | NMDAR1 | NR1 | glutamate receptor, ionotropic, N-methyl D-aspartate 1 | - | HPRD | 10862698 |
JUP | ARVD12 | CTNNG | DP3 | DPIII | PDGB | PKGB | junction plakoglobin | - | HPRD | 1639850 |
JUP | ARVD12 | CTNNG | DP3 | DPIII | PDGB | PKGB | junction plakoglobin | Affinity Capture-MS Affinity Capture-Western | BioGRID | 7650039 |14625392 |
LRRC7 | DKFZp686I1147 | KIAA1365 | MGC144918 | leucine rich repeat containing 7 | - | HPRD,BioGRID | 11729199 |
PKP4 | FLJ31261 | FLJ42243 | p0071 | plakophilin 4 | Two-hybrid | BioGRID | 12615965 |
PTPN1 | PTP1B | protein tyrosine phosphatase, non-receptor type 1 | - | HPRD | 12377785 |
RAB8B | FLJ38125 | RAB8B, member RAS oncogene family | Affinity Capture-Western | BioGRID | 12639940 |
RICS | GC-GAP | GRIT | KIAA0712 | MGC1892 | p200RhoGAP | p250GAP | Rho GTPase-activating protein | - | HPRD | 12531901 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG CELL ADHESION MOLECULES CAMS | 134 | 93 | All SZGR 2.0 genes in this pathway |
KEGG ARRHYTHMOGENIC RIGHT VENTRICULAR CARDIOMYOPATHY ARVC | 76 | 59 | All SZGR 2.0 genes in this pathway |
PID PTP1B PATHWAY | 52 | 40 | All SZGR 2.0 genes in this pathway |
PID AJDISS 2PATHWAY | 48 | 38 | All SZGR 2.0 genes in this pathway |
PID NCADHERIN PATHWAY | 33 | 32 | All SZGR 2.0 genes in this pathway |
PID FGF PATHWAY | 55 | 37 | All SZGR 2.0 genes in this pathway |
REACTOME DEVELOPMENTAL BIOLOGY | 396 | 292 | All SZGR 2.0 genes in this pathway |
REACTOME CELL CELL COMMUNICATION | 120 | 77 | All SZGR 2.0 genes in this pathway |
REACTOME ADHERENS JUNCTIONS INTERACTIONS | 27 | 20 | All SZGR 2.0 genes in this pathway |
REACTOME CELL CELL JUNCTION ORGANIZATION | 56 | 31 | All SZGR 2.0 genes in this pathway |
REACTOME CELL JUNCTION ORGANIZATION | 78 | 43 | All SZGR 2.0 genes in this pathway |
REACTOME MYOGENESIS | 28 | 20 | All SZGR 2.0 genes in this pathway |
GAZDA DIAMOND BLACKFAN ANEMIA PROGENITOR DN | 66 | 42 | All SZGR 2.0 genes in this pathway |
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA DN | 116 | 79 | All SZGR 2.0 genes in this pathway |
HORIUCHI WTAP TARGETS DN | 310 | 188 | All SZGR 2.0 genes in this pathway |
BOGNI TREATMENT RELATED MYELOID LEUKEMIA DN | 33 | 19 | All SZGR 2.0 genes in this pathway |
KIM WT1 TARGETS UP | 214 | 155 | All SZGR 2.0 genes in this pathway |
RODRIGUES THYROID CARCINOMA ANAPLASTIC UP | 722 | 443 | All SZGR 2.0 genes in this pathway |
COLDREN GEFITINIB RESISTANCE UP | 85 | 57 | All SZGR 2.0 genes in this pathway |
DELYS THYROID CANCER UP | 443 | 294 | All SZGR 2.0 genes in this pathway |
MARKEY RB1 ACUTE LOF DN | 228 | 137 | All SZGR 2.0 genes in this pathway |
HAMAI APOPTOSIS VIA TRAIL DN | 186 | 107 | All SZGR 2.0 genes in this pathway |
TAKAYAMA BOUND BY AR | 10 | 6 | All SZGR 2.0 genes in this pathway |
DACOSTA UV RESPONSE VIA ERCC3 XPCS DN | 88 | 71 | All SZGR 2.0 genes in this pathway |
LI CISPLATIN RESISTANCE UP | 28 | 20 | All SZGR 2.0 genes in this pathway |
KORKOLA YOLK SAC TUMOR | 62 | 33 | All SZGR 2.0 genes in this pathway |
DACOSTA UV RESPONSE VIA ERCC3 DN | 855 | 609 | All SZGR 2.0 genes in this pathway |
MARTORIATI MDM4 TARGETS FETAL LIVER DN | 514 | 319 | All SZGR 2.0 genes in this pathway |
WATTEL AUTONOMOUS THYROID ADENOMA UP | 73 | 47 | All SZGR 2.0 genes in this pathway |
CALVET IRINOTECAN SENSITIVE VS RESISTANT DN | 5 | 5 | All SZGR 2.0 genes in this pathway |
KARAKAS TGFB1 SIGNALING | 18 | 15 | All SZGR 2.0 genes in this pathway |
SCHAEFFER PROSTATE DEVELOPMENT 48HR DN | 428 | 306 | All SZGR 2.0 genes in this pathway |
GOTZMANN EPITHELIAL TO MESENCHYMAL TRANSITION UP | 69 | 55 | All SZGR 2.0 genes in this pathway |
BENPORATH NANOG TARGETS | 988 | 594 | All SZGR 2.0 genes in this pathway |
BENPORATH SOX2 TARGETS | 734 | 436 | All SZGR 2.0 genes in this pathway |
ONDER CDH1 TARGETS 2 UP | 256 | 159 | All SZGR 2.0 genes in this pathway |
JECHLINGER EPITHELIAL TO MESENCHYMAL TRANSITION UP | 71 | 51 | All SZGR 2.0 genes in this pathway |
MANALO HYPOXIA UP | 207 | 145 | All SZGR 2.0 genes in this pathway |
HSIAO LIVER SPECIFIC GENES | 244 | 154 | All SZGR 2.0 genes in this pathway |
LI WILMS TUMOR VS FETAL KIDNEY 1 DN | 163 | 115 | All SZGR 2.0 genes in this pathway |
PETROVA ENDOTHELIUM LYMPHATIC VS BLOOD DN | 162 | 102 | All SZGR 2.0 genes in this pathway |
KANG IMMORTALIZED BY TERT DN | 102 | 67 | All SZGR 2.0 genes in this pathway |
PETROVA PROX1 TARGETS DN | 64 | 38 | All SZGR 2.0 genes in this pathway |
MCCLUNG DELTA FOSB TARGETS 8WK | 47 | 38 | All SZGR 2.0 genes in this pathway |
WEIGEL OXIDATIVE STRESS BY HNE AND H2O2 | 39 | 29 | All SZGR 2.0 genes in this pathway |
MODY HIPPOCAMPUS NEONATAL | 35 | 25 | All SZGR 2.0 genes in this pathway |
ZHANG PROLIFERATING VS QUIESCENT | 51 | 41 | All SZGR 2.0 genes in this pathway |
KAAB HEART ATRIUM VS VENTRICLE DN | 261 | 183 | All SZGR 2.0 genes in this pathway |
RAMPON ENRICHED LEARNING ENVIRONMENT LATE UP | 22 | 16 | All SZGR 2.0 genes in this pathway |
GENTILE UV LOW DOSE DN | 67 | 46 | All SZGR 2.0 genes in this pathway |
CLASPER LYMPHATIC VESSELS DURING METASTASIS DN | 36 | 23 | All SZGR 2.0 genes in this pathway |
WALLACE PROSTATE CANCER RACE UP | 299 | 167 | All SZGR 2.0 genes in this pathway |
ACEVEDO LIVER TUMOR VS NORMAL ADJACENT TISSUE DN | 274 | 165 | All SZGR 2.0 genes in this pathway |
NADELLA PRKAR1A TARGETS DN | 8 | 8 | All SZGR 2.0 genes in this pathway |
SMID BREAST CANCER BASAL UP | 648 | 398 | All SZGR 2.0 genes in this pathway |
BOCHKIS FOXA2 TARGETS | 425 | 261 | All SZGR 2.0 genes in this pathway |
BOQUEST STEM CELL CULTURED VS FRESH UP | 425 | 298 | All SZGR 2.0 genes in this pathway |
LABBE TARGETS OF TGFB1 AND WNT3A UP | 111 | 70 | All SZGR 2.0 genes in this pathway |
WEST ADRENOCORTICAL TUMOR DN | 546 | 362 | All SZGR 2.0 genes in this pathway |
ALONSO METASTASIS EMT UP | 36 | 24 | All SZGR 2.0 genes in this pathway |
ALONSO METASTASIS UP | 198 | 128 | All SZGR 2.0 genes in this pathway |
JIANG TIP30 TARGETS UP | 46 | 28 | All SZGR 2.0 genes in this pathway |
BOYLAN MULTIPLE MYELOMA C D DN | 252 | 155 | All SZGR 2.0 genes in this pathway |
HELLEBREKERS SILENCED DURING TUMOR ANGIOGENESIS | 80 | 56 | All SZGR 2.0 genes in this pathway |
GU PDEF TARGETS UP | 71 | 49 | All SZGR 2.0 genes in this pathway |
LINDSTEDT DENDRITIC CELL MATURATION D | 68 | 44 | All SZGR 2.0 genes in this pathway |
HINATA NFKB TARGETS FIBROBLAST UP | 84 | 60 | All SZGR 2.0 genes in this pathway |
HAN SATB1 TARGETS UP | 395 | 249 | All SZGR 2.0 genes in this pathway |
YAGI AML WITH T 8 21 TRANSLOCATION | 368 | 247 | All SZGR 2.0 genes in this pathway |
DANG REGULATED BY MYC DN | 253 | 192 | All SZGR 2.0 genes in this pathway |
WONG ADULT TISSUE STEM MODULE | 721 | 492 | All SZGR 2.0 genes in this pathway |
VERHAAK GLIOBLASTOMA CLASSICAL | 162 | 122 | All SZGR 2.0 genes in this pathway |
DUTERTRE ESTRADIOL RESPONSE 24HR DN | 505 | 328 | All SZGR 2.0 genes in this pathway |
PILON KLF1 TARGETS UP | 504 | 321 | All SZGR 2.0 genes in this pathway |
PASINI SUZ12 TARGETS DN | 315 | 215 | All SZGR 2.0 genes in this pathway |
PLASARI TGFB1 TARGETS 10HR DN | 244 | 157 | All SZGR 2.0 genes in this pathway |
ABDELMOHSEN ELAVL4 TARGETS | 16 | 13 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-124/506 | 239 | 245 | m8 | hsa-miR-506 | UAAGGCACCCUUCUGAGUAGA |
hsa-miR-124brain | UAAGGCACGCGGUGAAUGCC | ||||
miR-129-5p | 976 | 982 | 1A | hsa-miR-129brain | CUUUUUGCGGUCUGGGCUUGC |
hsa-miR-129-5p | CUUUUUGCGGUCUGGGCUUGCU | ||||
miR-144 | 170 | 176 | m8 | hsa-miR-144 | UACAGUAUAGAUGAUGUACUAG |
miR-190 | 580 | 586 | 1A | hsa-miR-190 | UGAUAUGUUUGAUAUAUUAGGU |
miR-194 | 382 | 388 | 1A | hsa-miR-194 | UGUAACAGCAACUCCAUGUGGA |
miR-204/211 | 568 | 574 | m8 | hsa-miR-204brain | UUCCCUUUGUCAUCCUAUGCCU |
hsa-miR-211 | UUCCCUUUGUCAUCCUUCGCCU | ||||
miR-208 | 642 | 648 | 1A | hsa-miR-208 | AUAAGACGAGCAAAAAGCUUGU |
miR-218 | 949 | 955 | 1A | hsa-miR-218brain | UUGUGCUUGAUCUAACCAUGU |
miR-221/222 | 593 | 599 | 1A | hsa-miR-221brain | AGCUACAUUGUCUGCUGGGUUUC |
hsa-miR-222brain | AGCUACAUCUGGCUACUGGGUCUC | ||||
miR-26 | 202 | 208 | 1A | hsa-miR-26abrain | UUCAAGUAAUCCAGGAUAGGC |
hsa-miR-26bSZ | UUCAAGUAAUUCAGGAUAGGUU | ||||
miR-320 | 1101 | 1107 | m8 | hsa-miR-320 | AAAAGCUGGGUUGAGAGGGCGAA |
miR-338 | 109 | 115 | 1A | hsa-miR-338brain | UCCAGCAUCAGUGAUUUUGUUGA |
miR-369-3p | 766 | 772 | m8 | hsa-miR-369-3p | AAUAAUACAUGGUUGAUCUUU |
miR-493-5p | 484 | 490 | m8 | hsa-miR-493-5p | UUGUACAUGGUAGGCUUUCAUU |
hsa-miR-493-5p | UUGUACAUGGUAGGCUUUCAUU | ||||
miR-495 | 380 | 386 | 1A | hsa-miR-495brain | AAACAAACAUGGUGCACUUCUUU |
miR-499 | 642 | 648 | 1A | hsa-miR-499 | UUAAGACUUGCAGUGAUGUUUAA |
miR-543 | 623 | 630 | 1A,m8 | hsa-miR-543 | AAACAUUCGCGGUGCACUUCU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.