Gene Page: PDCD6
Summary ?
| GeneID | 10016 |
| Symbol | PDCD6 |
| Synonyms | ALG-2|ALG2|PEF1B |
| Description | programmed cell death 6 |
| Reference | MIM:601057|HGNC:HGNC:8765|Ensembl:ENSG00000249915|HPRD:03035|Vega:OTTHUMG00000090283 |
| Gene type | protein-coding |
| Map location | 5p15.33 |
| Pascal p-value | 0.312 |
| Sherlock p-value | 0.804 |
| Fetal beta | -0.555 |
| DMG | 1 (# studies) |
| eGene | Caudate basal ganglia Cerebellar Hemisphere Cerebellum |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 2 |
| Network | Shortest path distance of core genes in the Human protein-protein interaction network | Contribution to shortest path in PPI network: 0.0387 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
| Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
|---|---|---|---|---|---|---|---|
| cg05694825 | 5 | 292125 | PDCD6 | 9.48E-6 | 0.563 | 0.013 | DMG:Wockner_2014 |
| cg13707777 | 5 | 308627 | AHRR;PDCD6 | 2.05E-5 | 0.33 | 0.016 | DMG:Wockner_2014 |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| LY96 | 0.85 | 0.80 |
| CGRRF1 | 0.84 | 0.74 |
| PXMP3 | 0.81 | 0.76 |
| SCRG1 | 0.78 | 0.69 |
| LST1 | 0.74 | 0.77 |
| PIGB | 0.74 | 0.68 |
| NDUFB1 | 0.74 | 0.56 |
| MTCP1NB | 0.71 | 0.64 |
| C18orf32 | 0.71 | 0.49 |
| MED31 | 0.70 | 0.52 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| CDC2L2 | -0.59 | -0.65 |
| SUPT6H | -0.58 | -0.62 |
| MYO18A | -0.58 | -0.59 |
| TNKS1BP1 | -0.58 | -0.65 |
| SAFB2 | -0.58 | -0.63 |
| HNRNPUL2 | -0.57 | -0.57 |
| SART1 | -0.56 | -0.64 |
| LONP1 | -0.56 | -0.53 |
| PELP1 | -0.56 | -0.65 |
| DDX42 | -0.55 | -0.56 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0005509 | calcium ion binding | ISS | - | |
| GO:0048306 | calcium-dependent protein binding | IPI | 17196169 |17214967 | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0006915 | apoptosis | IEA | - | |
| GO:0008624 | induction of apoptosis by extracellular signals | TAS | 8560270 | |
| GO:0051592 | response to calcium ion | ISS | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005789 | endoplasmic reticulum membrane | IEA | - | |
| GO:0005634 | nucleus | IDA | 17196169 | |
| GO:0005783 | endoplasmic reticulum | IDA | 17196169 | |
| GO:0016020 | membrane | IEA | - | |
| GO:0031965 | nuclear membrane | IEA | - |
Section IV. Protein-protein interaction annotation
| Interactors | Aliases B | Official full name B | Experimental | Source | PubMed ID |
|---|---|---|---|---|---|
| ANXA11 | ANX11 | CAP50 | annexin A11 | - | HPRD,BioGRID | 11883939 |
| CPNE1 | COPN1 | CPN1 | MGC1142 | copine I | - | HPRD | 12522145 |
| CPNE2 | COPN2 | CPN2 | DKFZp686E06199 | MGC16924 | copine II | - | HPRD | 12522145 |
| CPNE4 | COPN4 | CPN4 | MGC15604 | copine IV | - | HPRD | 12522145 |
| FAS | ALPS1A | APO-1 | APT1 | CD95 | FAS1 | FASTM | TNFRSF6 | Fas (TNF receptor superfamily, member 6) | - | HPRD,BioGRID | 11606059 |
| FASLG | APT1LG1 | CD178 | CD95L | FASL | TNFSF6 | Fas ligand (TNF superfamily, member 6) | - | HPRD | 11606059 |
| HEBP2 | C6ORF34B | C6orf34 | KIAA1244 | PP23 | SOUL | heme binding protein 2 | Two-hybrid | BioGRID | 16189514 |
| MAP3K5 | ASK1 | MAPKKK5 | MEKK5 | mitogen-activated protein kinase kinase kinase 5 | - | HPRD,BioGRID | 12372597 |
| MAPK1IP1L | C14orf32 | MGC23138 | MISS | c14_5346 | mitogen-activated protein kinase 1 interacting protein 1-like | Two-hybrid | BioGRID | 16189514 |
| PDCD6 | ALG-2 | FLJ46208 | MGC111017 | MGC119050 | MGC9123 | PEF1B | programmed cell death 6 | Two-hybrid | BioGRID | 16189514 |
| PDCD6IP | AIP1 | Alix | DRIP4 | HP95 | MGC17003 | programmed cell death 6 interacting protein | - | HPRD,BioGRID | 9880530 |
| PEF1 | PEF1A | PEFLIN | penta-EF-hand domain containing 1 | - | HPRD,BioGRID | 11278427 |
| SH3KBP1 | CIN85 | GIG10 | MIG18 | SH3-domain kinase binding protein 1 | - | HPRD,BioGRID | 10858458 |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| PARENT MTOR SIGNALING UP | 567 | 375 | All SZGR 2.0 genes in this pathway |
| DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP | 1382 | 904 | All SZGR 2.0 genes in this pathway |
| BORCZUK MALIGNANT MESOTHELIOMA UP | 305 | 185 | All SZGR 2.0 genes in this pathway |
| VECCHI GASTRIC CANCER EARLY UP | 430 | 232 | All SZGR 2.0 genes in this pathway |
| OSMAN BLADDER CANCER DN | 406 | 230 | All SZGR 2.0 genes in this pathway |
| LAU APOPTOSIS CDKN2A UP | 55 | 40 | All SZGR 2.0 genes in this pathway |
| LI AMPLIFIED IN LUNG CANCER | 178 | 108 | All SZGR 2.0 genes in this pathway |
| SCHLOSSER SERUM RESPONSE DN | 712 | 443 | All SZGR 2.0 genes in this pathway |
| SPIELMAN LYMPHOBLAST EUROPEAN VS ASIAN DN | 584 | 395 | All SZGR 2.0 genes in this pathway |
| NUYTTEN NIPP1 TARGETS UP | 769 | 437 | All SZGR 2.0 genes in this pathway |
| LOCKWOOD AMPLIFIED IN LUNG CANCER | 214 | 139 | All SZGR 2.0 genes in this pathway |
| WEI MYCN TARGETS WITH E BOX | 795 | 478 | All SZGR 2.0 genes in this pathway |
| KOYAMA SEMA3B TARGETS DN | 411 | 249 | All SZGR 2.0 genes in this pathway |
| STARK PREFRONTAL CORTEX 22Q11 DELETION DN | 517 | 309 | All SZGR 2.0 genes in this pathway |
| NIKOLSKY BREAST CANCER 5P15 AMPLICON | 26 | 15 | All SZGR 2.0 genes in this pathway |
| NIKOLSKY MUTATED AND AMPLIFIED IN BREAST CANCER | 94 | 60 | All SZGR 2.0 genes in this pathway |
| DING LUNG CANCER EXPRESSION BY COPY NUMBER | 100 | 62 | All SZGR 2.0 genes in this pathway |
| ONDER CDH1 TARGETS 1 UP | 140 | 85 | All SZGR 2.0 genes in this pathway |
| GOLDRATH HOMEOSTATIC PROLIFERATION | 171 | 102 | All SZGR 2.0 genes in this pathway |
| FLECHNER BIOPSY KIDNEY TRANSPLANT OK VS DONOR UP | 555 | 346 | All SZGR 2.0 genes in this pathway |
| MOREAUX MULTIPLE MYELOMA BY TACI UP | 412 | 249 | All SZGR 2.0 genes in this pathway |
| MOREAUX MULTIPLE MYELOMA BY TACI DN | 172 | 107 | All SZGR 2.0 genes in this pathway |
| KUMAR TARGETS OF MLL AF9 FUSION | 405 | 264 | All SZGR 2.0 genes in this pathway |
| REN ALVEOLAR RHABDOMYOSARCOMA DN | 408 | 274 | All SZGR 2.0 genes in this pathway |
| KAAB FAILED HEART ATRIUM DN | 141 | 99 | All SZGR 2.0 genes in this pathway |
| BACOLOD RESISTANCE TO ALKYLATING AGENTS DN | 60 | 45 | All SZGR 2.0 genes in this pathway |
| CREIGHTON ENDOCRINE THERAPY RESISTANCE 5 | 482 | 296 | All SZGR 2.0 genes in this pathway |
| BONOME OVARIAN CANCER SURVIVAL SUBOPTIMAL DEBULKING | 510 | 309 | All SZGR 2.0 genes in this pathway |
| GRADE COLON CANCER UP | 871 | 505 | All SZGR 2.0 genes in this pathway |
| GRADE COLON AND RECTAL CANCER UP | 285 | 167 | All SZGR 2.0 genes in this pathway |
| MOOTHA PGC | 420 | 269 | All SZGR 2.0 genes in this pathway |
| AGUIRRE PANCREATIC CANCER COPY NUMBER UP | 298 | 174 | All SZGR 2.0 genes in this pathway |
| YAO TEMPORAL RESPONSE TO PROGESTERONE CLUSTER 12 | 79 | 54 | All SZGR 2.0 genes in this pathway |
| PURBEY TARGETS OF CTBP1 AND SATB1 DN | 180 | 116 | All SZGR 2.0 genes in this pathway |
| RATTENBACHER BOUND BY CELF1 | 467 | 251 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-124.1 | 381 | 387 | m8 | hsa-miR-124a | UUAAGGCACGCGGUGAAUGCCA |
| miR-124/506 | 380 | 387 | 1A,m8 | hsa-miR-506 | UAAGGCACCCUUCUGAGUAGA |
| hsa-miR-124brain | UAAGGCACGCGGUGAAUGCC | ||||
| miR-137 | 433 | 440 | 1A,m8 | hsa-miR-137 | UAUUGCUUAAGAAUACGCGUAG |
| miR-183 | 227 | 233 | m8 | hsa-miR-183 | UAUGGCACUGGUAGAAUUCACUG |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.