Gene Page: UST
Summary ?
| GeneID | 10090 |
| Symbol | UST |
| Synonyms | 2OST |
| Description | uronyl 2-sulfotransferase |
| Reference | MIM:610752|HGNC:HGNC:17223|Ensembl:ENSG00000111962|HPRD:10298|Vega:OTTHUMG00000016135 |
| Gene type | protein-coding |
| Map location | 6q25.1 |
| Pascal p-value | 0.397 |
| Sherlock p-value | 0.623 |
| Fetal beta | 0.312 |
| eGene | Caudate basal ganglia Myers' cis & trans |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:GWASdb | Genome-wide Association Studies | GWASdb records for schizophrenia | |
| CV:PGCnp | Genome-wide Association Study | GWAS |
Section I. Genetics and epigenetics annotation
eQTL annotation
| SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
|---|---|---|---|---|---|---|---|---|
| rs10186260 | chr2 | 129538777 | UST | 10090 | 0.09 | trans | ||
| rs2683815 | chr2 | 142078002 | UST | 10090 | 0.02 | trans | ||
| rs12490351 | chr3 | 191894097 | UST | 10090 | 0.17 | trans | ||
| rs1460926 | chr3 | 191894249 | UST | 10090 | 0.17 | trans | ||
| rs1981925 | chr4 | 34348578 | UST | 10090 | 0.16 | trans | ||
| rs2268637 | chr6 | 39050917 | UST | 10090 | 0.13 | trans | ||
| rs17836464 | chr12 | 4066927 | UST | 10090 | 0 | trans | ||
| rs16947436 | chr13 | 92988845 | UST | 10090 | 0.08 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| HNRNPH1 | 0.97 | 0.98 |
| HNRNPU | 0.97 | 0.97 |
| NCBP2 | 0.97 | 0.96 |
| TOP2B | 0.96 | 0.97 |
| DHX9 | 0.96 | 0.95 |
| CNOT2 | 0.96 | 0.95 |
| CTCF | 0.96 | 0.97 |
| SUPT16H | 0.96 | 0.96 |
| EPC1 | 0.96 | 0.96 |
| KHDRBS1 | 0.96 | 0.97 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| AF347015.31 | -0.76 | -0.91 |
| HLA-F | -0.76 | -0.80 |
| AIFM3 | -0.75 | -0.80 |
| AF347015.27 | -0.74 | -0.89 |
| MT-CO2 | -0.74 | -0.91 |
| FXYD1 | -0.74 | -0.90 |
| TSC22D4 | -0.74 | -0.83 |
| C5orf53 | -0.74 | -0.76 |
| IFI27 | -0.73 | -0.89 |
| S100B | -0.73 | -0.83 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0016740 | transferase activity | IEA | - | |
| GO:0008146 | sulfotransferase activity | TAS | 10187838 | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0006477 | protein amino acid sulfation | TAS | 10187838 | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0000139 | Golgi membrane | IEA | - | |
| GO:0005794 | Golgi apparatus | IEA | - | |
| GO:0016020 | membrane | IEA | - | |
| GO:0016021 | integral to membrane | TAS | 10187838 |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| KEGG GLYCOSAMINOGLYCAN BIOSYNTHESIS CHONDROITIN SULFATE | 22 | 16 | All SZGR 2.0 genes in this pathway |
| REACTOME CHONDROITIN SULFATE DERMATAN SULFATE METABOLISM | 49 | 33 | All SZGR 2.0 genes in this pathway |
| REACTOME GLYCOSAMINOGLYCAN METABOLISM | 111 | 69 | All SZGR 2.0 genes in this pathway |
| REACTOME METABOLISM OF CARBOHYDRATES | 247 | 154 | All SZGR 2.0 genes in this pathway |
| GARY CD5 TARGETS UP | 473 | 314 | All SZGR 2.0 genes in this pathway |
| OSMAN BLADDER CANCER DN | 406 | 230 | All SZGR 2.0 genes in this pathway |
| TAKEDA TARGETS OF NUP98 HOXA9 FUSION 10D UP | 194 | 122 | All SZGR 2.0 genes in this pathway |
| DODD NASOPHARYNGEAL CARCINOMA UP | 1821 | 933 | All SZGR 2.0 genes in this pathway |
| RODRIGUES THYROID CARCINOMA POORLY DIFFERENTIATED DN | 805 | 505 | All SZGR 2.0 genes in this pathway |
| RODRIGUES THYROID CARCINOMA ANAPLASTIC DN | 537 | 339 | All SZGR 2.0 genes in this pathway |
| DACOSTA UV RESPONSE VIA ERCC3 TTD DN | 84 | 63 | All SZGR 2.0 genes in this pathway |
| DACOSTA UV RESPONSE VIA ERCC3 DN | 855 | 609 | All SZGR 2.0 genes in this pathway |
| NUYTTEN EZH2 TARGETS UP | 1037 | 673 | All SZGR 2.0 genes in this pathway |
| BERTUCCI INVASIVE CARCINOMA DUCTAL VS LOBULAR UP | 25 | 17 | All SZGR 2.0 genes in this pathway |
| SASAKI ADULT T CELL LEUKEMIA | 176 | 122 | All SZGR 2.0 genes in this pathway |
| BLALOCK ALZHEIMERS DISEASE UP | 1691 | 1088 | All SZGR 2.0 genes in this pathway |
| ZHENG BOUND BY FOXP3 | 491 | 310 | All SZGR 2.0 genes in this pathway |
| MARSON BOUND BY E2F4 UNSTIMULATED | 728 | 415 | All SZGR 2.0 genes in this pathway |
| STEIN ESRRA TARGETS UP | 388 | 234 | All SZGR 2.0 genes in this pathway |
| KONDO EZH2 TARGETS | 245 | 148 | All SZGR 2.0 genes in this pathway |
| BOQUEST STEM CELL UP | 260 | 174 | All SZGR 2.0 genes in this pathway |
| CHIANG LIVER CANCER SUBCLASS CTNNB1 UP | 176 | 110 | All SZGR 2.0 genes in this pathway |
| STEIN ESRRA TARGETS | 535 | 325 | All SZGR 2.0 genes in this pathway |
| BHAT ESR1 TARGETS NOT VIA AKT1 UP | 211 | 131 | All SZGR 2.0 genes in this pathway |
| BHAT ESR1 TARGETS VIA AKT1 UP | 281 | 183 | All SZGR 2.0 genes in this pathway |
| GOBERT OLIGODENDROCYTE DIFFERENTIATION DN | 1080 | 713 | All SZGR 2.0 genes in this pathway |
| DURAND STROMA S UP | 297 | 194 | All SZGR 2.0 genes in this pathway |
| ZWANG TRANSIENTLY UP BY 1ST EGF PULSE ONLY | 1839 | 928 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-1/206 | 114 | 120 | m8 | hsa-miR-1 | UGGAAUGUAAAGAAGUAUGUA |
| hsa-miR-206SZ | UGGAAUGUAAGGAAGUGUGUGG | ||||
| hsa-miR-613 | AGGAAUGUUCCUUCUUUGCC | ||||
| hsa-miR-1 | UGGAAUGUAAAGAAGUAUGUA | ||||
| hsa-miR-206SZ | UGGAAUGUAAGGAAGUGUGUGG | ||||
| hsa-miR-613 | AGGAAUGUUCCUUCUUUGCC | ||||
| miR-150 | 136 | 143 | 1A,m8 | hsa-miR-150 | UCUCCCAACCCUUGUACCAGUG |
| miR-155 | 97 | 103 | 1A | hsa-miR-155 | UUAAUGCUAAUCGUGAUAGGGG |
| miR-369-3p | 2604 | 2610 | 1A | hsa-miR-369-3p | AAUAAUACAUGGUUGAUCUUU |
| miR-374 | 2604 | 2611 | 1A,m8 | hsa-miR-374 | UUAUAAUACAACCUGAUAAGUG |
| miR-378 | 2642 | 2648 | 1A | hsa-miR-378 | CUCCUGACUCCAGGUCCUGUGU |
| miR-409-3p | 113 | 119 | m8 | hsa-miR-409-3p | CGAAUGUUGCUCGGUGAACCCCU |
| miR-433-3p | 1865 | 1871 | m8 | hsa-miR-433brain | AUCAUGAUGGGCUCCUCGGUGU |
| hsa-miR-433brain | AUCAUGAUGGGCUCCUCGGUGU | ||||
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.