Summary ?
GeneID10178
SymbolTENM1
SynonymsODZ1|ODZ3|TEN-M1|TNM|TNM1
Descriptionteneurin transmembrane protein 1
ReferenceMIM:300588|HGNC:HGNC:8117|Ensembl:ENSG00000009694|HPRD:06669|Vega:OTTHUMG00000022721
Gene typeprotein-coding
Map locationXq25

Gene in Data Sources
Gene set name Method of gene setDescriptionInfo
CV:PGCnpGenome-wide Association StudyGWAS
DNM:Gulsuner_2013Whole Exome Sequencing analysis155 DNMs identified by exome sequencing of quads or trios of schizophrenia individuals and their parents.

Section I. Genetics and epigenetics annotation

@DNM table

GeneChromosomePositionRefAltTranscriptAA changeMutation typeSiftCG46TraitStudy
TENM1chrX123526073CTNM_001163278
NM_001163279
NM_014253
p.1839W>*
p.1838W>*
p.1832W>*
nonsense
nonsense
nonsense
SchizophreniaDNM:Gulsuner_2013


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
GenePearson's Correlation Spearman's Correlation
FAM20A0.840.48
AC079210.10.840.51
GRID2IP0.810.59
NEXN0.81-0.04
RGS160.800.17
CARD110.80-0.08
ATP2A30.800.38
RGS30.790.21
CCDC1360.790.41
FAM19A40.79-0.17
Top 10 negatively co-expressed genes
GenePearson's Correlation Spearman's Correlation
CXCL14-0.30-0.68
SPARCL1-0.30-0.56
OAF-0.29-0.71
TNFSF12-0.27-0.61
GRASP-0.27-0.55
RLBP1-0.27-0.67
COX4I2-0.27-0.69
SERTAD1-0.27-0.63
AF347015.2-0.26-0.70
ITPKA-0.26-0.57

Section III. Gene Ontology annotation

Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0008201heparin bindingTAS10341219 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0007399nervous system developmentTASneurite (GO term level: 5)10341219 
GO:0007165signal transductionIEA-
GO:0008285negative regulation of cell proliferationTAS10556288 
GO:0006955immune responseTAS10556288 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005576extracellular regionTAS10341219 
GO:0016020membraneIEA-
GO:0016021integral to membraneIEA-

Section VI. microRNA annotation

miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-124/50623992405m8hsa-miR-506UAAGGCACCCUUCUGAGUAGA
hsa-miR-124brainUAAGGCACGCGGUGAAUGCC
miR-14915731579m8hsa-miR-149brainUCUGGCUCCGUGUCUUCACUCC
miR-153172617321Ahsa-miR-153UUGCAUAGUCACAAAAGUGA
miR-17-5p/20/93.mr/106/519.d24452451m8hsa-miR-17-5pCAAAGUGCUUACAGUGCAGGUAGU
hsa-miR-20abrainUAAAGUGCUUAUAGUGCAGGUAG
hsa-miR-106aAAAAGUGCUUACAGUGCAGGUAGC
hsa-miR-106bSZUAAAGUGCUGACAGUGCAGAU
hsa-miR-20bSZCAAAGUGCUCAUAGUGCAGGUAG
hsa-miR-519dCAAAGUGCCUCCCUUUAGAGUGU
miR-18616541660m8hsa-miR-186CAAAGAAUUCUCCUUUUGGGCUU
miR-190114120m8hsa-miR-190UGAUAUGUUUGAUAUAUUAGGU
miR-196166816741Ahsa-miR-196aUAGGUAGUUUCAUGUUGUUGG
hsa-miR-196bUAGGUAGUUUCCUGUUGUUGG
miR-200bc/429212218m8hsa-miR-200bUAAUACUGCCUGGUAAUGAUGAC
hsa-miR-200cUAAUACUGCCGGGUAAUGAUGG
hsa-miR-429UAAUACUGUCUGGUAAAACCGU
miR-203.1120512121A,m8hsa-miR-203UGAAAUGUUUAGGACCACUAG
miR-23133139m8hsa-miR-23abrainAUCACAUUGCCAGGGAUUUCC
hsa-miR-23bbrainAUCACAUUGCCAGGGAUUACC
miR-3231331391Ahsa-miR-323brainGCACAUUACACGGUCGACCUCU
miR-3296736791Ahsa-miR-329brainAACACACCUGGUUAACCUCUUU
miR-34/4494324381Ahsa-miR-34abrainUGGCAGUGUCUUAGCUGGUUGUU
hsa-miR-34cAGGCAGUGUAGUUAGCUGAUUGC
hsa-miR-449UGGCAGUGUAUUGUUAGCUGGU
hsa-miR-449bAGGCAGUGUAUUGUUAGCUGGC
miR-34b123129m8hsa-miR-34bUAGGCAGUGUCAUUAGCUGAUUG
hsa-miR-34bUAGGCAGUGUCAUUAGCUGAUUG
hsa-miR-34bUAGGCAGUGUCAUUAGCUGAUUG
miR-369-3p242724341A,m8hsa-miR-369-3pAAUAAUACAUGGUUGAUCUUU
miR-37424282434m8hsa-miR-374UUAUAAUACAACCUGAUAAGUG
miR-378243624421Ahsa-miR-378CUCCUGACUCCAGGUCCUGUGU
miR-4108158211Ahsa-miR-410AAUAUAACACAGAUGGCCUGU
miR-448172517321A,m8hsa-miR-448UUGCAUAUGUAGGAUGUCCCAU
miR-495162168m8hsa-miR-495brainAAACAAACAUGGUGCACUUCUUU
miR-496951011Ahsa-miR-496AUUACAUGGCCAAUCUC
miR-505206020661Ahsa-miR-505GUCAACACUUGCUGGUUUCCUC
miR-5398068131A,m8hsa-miR-539GGAGAAAUUAUCCUUGGUGUGU
miR-54499610031A,m8hsa-miR-544AUUCUGCAUUUUUAGCAAGU
miR-925321A,m8hsa-miR-9SZUCUUUGGUUAUCUAGCUGUAUGA