SZGR2

Summary ?

GeneID	10395
Symbol	DLC1
Synonyms	ARHGAP7\|HP\|STARD12\|p122-RhoGAP
Description	DLC1 Rho GTPase activating protein
Reference	MIM:604258\|HGNC:HGNC:2897\|Ensembl:ENSG00000164741\|HPRD:05035\|Vega:OTTHUMG00000090825
Gene type	protein-coding
Map location	8p22
Pascal p-value	0.281
Fetal beta	-1.3
eGene	Putamen basal ganglia
Support	CompositeSet Darnell FMRP targets Ascano FMRP targets

Gene in Data Sources

Gene set name	Method of gene set	Description
CV:GWAScat	Genome-wide Association Studies	This data set includes 560 SNPs associated with schizophrenia. A total of 486 genes were mapped to these SNPs within 50kb.
CV:GWASdb	Genome-wide Association Studies	GWASdb records for schizophrenia
CV:PGCnp	Genome-wide Association Study	GWAS
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 4

Section I. Genetics and epigenetics annotation

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	pvalue	qvalue	TSS distance	eQTL type
rs2119908	8	12986249	DLC1	ENSG00000164741.10	7.275E-7	0.01	386918	gtex_brain_putamen_basal
rs4831399	8	12986826	DLC1	ENSG00000164741.10	3.099E-7	0.01	386341	gtex_brain_putamen_basal
rs7829204	8	12987236	DLC1	ENSG00000164741.10	3.612E-7	0.01	385931	gtex_brain_putamen_basal
rs62493016	8	12989691	DLC1	ENSG00000164741.10	4.536E-7	0.01	383476	gtex_brain_putamen_basal
rs10107321	8	12990422	DLC1	ENSG00000164741.10	5.572E-7	0.01	382745	gtex_brain_putamen_basal
rs13275331	8	12990518	DLC1	ENSG00000164741.10	5.729E-7	0.01	382649	gtex_brain_putamen_basal
rs17553586	8	12990818	DLC1	ENSG00000164741.10	2.91E-7	0.01	382349	gtex_brain_putamen_basal
rs13253885	8	12990948	DLC1	ENSG00000164741.10	6.633E-7	0.01	382219	gtex_brain_putamen_basal
rs6531026	8	12991625	DLC1	ENSG00000164741.10	3.735E-7	0.01	381542	gtex_brain_putamen_basal
rs10086729	8	12992111	DLC1	ENSG00000164741.10	4.382E-7	0.01	381056	gtex_brain_putamen_basal
rs13280448	8	12992763	DLC1	ENSG00000164741.10	5.456E-7	0.01	380404	gtex_brain_putamen_basal
rs12334796	8	12993284	DLC1	ENSG00000164741.10	6.6E-7	0.01	379883	gtex_brain_putamen_basal
rs10103017	8	12993815	DLC1	ENSG00000164741.10	4.974E-7	0.01	379352	gtex_brain_putamen_basal
rs10089272	8	12994259	DLC1	ENSG00000164741.10	1.084E-6	0.01	378908	gtex_brain_putamen_basal
rs6982268	8	12994642	DLC1	ENSG00000164741.10	5.386E-7	0.01	378525	gtex_brain_putamen_basal
rs7015013	8	12995743	DLC1	ENSG00000164741.10	9.996E-7	0.01	377424	gtex_brain_putamen_basal
rs12546051	8	12996469	DLC1	ENSG00000164741.10	1.104E-6	0.01	376698	gtex_brain_putamen_basal

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
ATP5L	0.88	0.89
TXN2	0.87	0.87
PSMB3	0.87	0.86
RBX1	0.87	0.86
MRPL11	0.86	0.86
EIF3K	0.86	0.87
SUCLG1	0.86	0.85
ICT1	0.85	0.83
ZNF32	0.85	0.81
ASNA1	0.85	0.84

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
AF347015.26	-0.49	-0.52
SEMA3G	-0.48	-0.49
EPAS1	-0.46	-0.50
ABCB1	-0.46	-0.48
FAM38A	-0.46	-0.50
SLC6A12	-0.46	-0.49
MYH9	-0.45	-0.41
SHE	-0.45	-0.48
FLT1	-0.45	-0.52
AF347015.2	-0.45	-0.47

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005096	GTPase activator activity	IEA		-
GO:0005515	protein binding	IPI		16951145
GO:0042169	SH2 domain binding	IPI		17190795
GO:0030675	Rac GTPase activator activity	IDA		17932950
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0021575	hindbrain morphogenesis	IEA	Brain (GO term level: 9)	-
GO:0021575	hindbrain morphogenesis	ISS	Brain (GO term level: 9)	-
GO:0030900	forebrain development	IEA	Brain (GO term level: 8)	-
GO:0030900	forebrain development	ISS	Brain (GO term level: 8)	-
GO:0003007	heart morphogenesis	IEA		-
GO:0003007	heart morphogenesis	ISS		-
GO:0001843	neural tube closure	IEA		-
GO:0001843	neural tube closure	ISS		-
GO:0006917	induction of apoptosis	IDA		17292327 \|17888903
GO:0007165	signal transduction	IEA		-
GO:0008285	negative regulation of cell proliferation	IDA		12545165 \|17932950
GO:0008285	negative regulation of cell proliferation	IMP		17292327
GO:0008360	regulation of cell shape	IMP		17292327
GO:0048041	focal adhesion formation	IEA		-
GO:0048041	focal adhesion formation	ISS		-
GO:0006919	caspase activation	IDA		17888903
GO:0030036	actin cytoskeleton organization	IEA		-
GO:0035024	negative regulation of Rho protein signal transduction	IMP		16951145
GO:0032956	regulation of actin cytoskeleton organization	IMP		17292327
GO:0030336	negative regulation of cell migration	IDA		17932950
GO:0030336	negative regulation of cell migration	IMP		17292327 \|17888903
GO:0035307	positive regulation of protein amino acid dephosphorylation	IDA		17292327
GO:0051497	negative regulation of stress fiber formation	IDA		17932950
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005622	intracellular	IEA		-
GO:0005634	nucleus	IDA		17888903
GO:0005737	cytoplasm	IDA		16951145 \|17888903
GO:0005925	focal adhesion	IDA		16951145 \|17190795
GO:0005901	caveola	IPI		16951145

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
PID RHOA REG PATHWAY	46	30	All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY RHO GTPASES	113	81	All SZGR 2.0 genes in this pathway
ONKEN UVEAL MELANOMA DN	526	357	All SZGR 2.0 genes in this pathway
BERTUCCI MEDULLARY VS DUCTAL BREAST CANCER DN	169	118	All SZGR 2.0 genes in this pathway
DAVICIONI MOLECULAR ARMS VS ERMS DN	182	111	All SZGR 2.0 genes in this pathway
THUM SYSTOLIC HEART FAILURE DN	244	147	All SZGR 2.0 genes in this pathway
CASORELLI ACUTE PROMYELOCYTIC LEUKEMIA DN	663	425	All SZGR 2.0 genes in this pathway
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP	1382	904	All SZGR 2.0 genes in this pathway
BASAKI YBX1 TARGETS UP	290	177	All SZGR 2.0 genes in this pathway
TAKEDA TARGETS OF NUP98 HOXA9 FUSION 8D UP	157	91	All SZGR 2.0 genes in this pathway
TAKEDA TARGETS OF NUP98 HOXA9 FUSION 10D UP	194	122	All SZGR 2.0 genes in this pathway
MULLIGHAN NPM1 MUTATED SIGNATURE 1 UP	276	165	All SZGR 2.0 genes in this pathway
MULLIGHAN MLL SIGNATURE 1 DN	242	165	All SZGR 2.0 genes in this pathway
LEE NEURAL CREST STEM CELL UP	146	99	All SZGR 2.0 genes in this pathway
KINSEY TARGETS OF EWSR1 FLII FUSION DN	329	219	All SZGR 2.0 genes in this pathway
KIM WT1 TARGETS DN	459	276	All SZGR 2.0 genes in this pathway
KIM WT1 TARGETS 12HR DN	209	122	All SZGR 2.0 genes in this pathway
GRAHAM CML QUIESCENT VS NORMAL QUIESCENT UP	87	45	All SZGR 2.0 genes in this pathway
GRAHAM CML DIVIDING VS NORMAL QUIESCENT UP	181	101	All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY SERUM DEPRIVATION UP	552	347	All SZGR 2.0 genes in this pathway
GRAESSMANN RESPONSE TO MC AND SERUM DEPRIVATION UP	211	136	All SZGR 2.0 genes in this pathway
ZIRN TRETINOIN RESPONSE WT1 UP	23	14	All SZGR 2.0 genes in this pathway
PEREZ TP63 TARGETS	355	243	All SZGR 2.0 genes in this pathway
DACOSTA ERCC3 ALLELE XPCS VS TTD DN	36	27	All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 DN	855	609	All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 COMMON DN	483	336	All SZGR 2.0 genes in this pathway
AMUNDSON RESPONSE TO ARSENITE	217	143	All SZGR 2.0 genes in this pathway
HATADA METHYLATED IN LUNG CANCER UP	390	236	All SZGR 2.0 genes in this pathway
SCHLESINGER METHYLATED DE NOVO IN CANCER	88	64	All SZGR 2.0 genes in this pathway
NUYTTEN NIPP1 TARGETS DN	848	527	All SZGR 2.0 genes in this pathway
KOYAMA SEMA3B TARGETS UP	292	168	All SZGR 2.0 genes in this pathway
BENPORATH SUZ12 TARGETS	1038	678	All SZGR 2.0 genes in this pathway
AMIT EGF RESPONSE 60 MCF10A	39	24	All SZGR 2.0 genes in this pathway
ONDER CDH1 TARGETS 2 UP	256	159	All SZGR 2.0 genes in this pathway
ROSS AML OF FAB M7 TYPE	68	44	All SZGR 2.0 genes in this pathway
YAGI AML FAB MARKERS	191	131	All SZGR 2.0 genes in this pathway
CUI TCF21 TARGETS 2 DN	830	547	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 12HR DN	101	64	All SZGR 2.0 genes in this pathway
MARCHINI TRABECTEDIN RESISTANCE DN	49	34	All SZGR 2.0 genes in this pathway
CREIGHTON ENDOCRINE THERAPY RESISTANCE 1	528	324	All SZGR 2.0 genes in this pathway
CREIGHTON ENDOCRINE THERAPY RESISTANCE 4	307	185	All SZGR 2.0 genes in this pathway
MASSARWEH TAMOXIFEN RESISTANCE DN	258	160	All SZGR 2.0 genes in this pathway
WALLACE PROSTATE CANCER RACE UP	299	167	All SZGR 2.0 genes in this pathway
ACEVEDO LIVER CANCER WITH H3K27ME3 UP	295	149	All SZGR 2.0 genes in this pathway
BASSO HAIRY CELL LEUKEMIA DN	80	66	All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS UP	1305	895	All SZGR 2.0 genes in this pathway
SHEDDEN LUNG CANCER GOOD SURVIVAL A4	196	124	All SZGR 2.0 genes in this pathway
MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3	1069	729	All SZGR 2.0 genes in this pathway
VALK AML WITH CEBPA	37	27	All SZGR 2.0 genes in this pathway
WONG ADULT TISSUE STEM MODULE	721	492	All SZGR 2.0 genes in this pathway
VERHAAK GLIOBLASTOMA CLASSICAL	162	122	All SZGR 2.0 genes in this pathway
PILON KLF1 TARGETS UP	504	321	All SZGR 2.0 genes in this pathway
PEDERSEN METASTASIS BY ERBB2 ISOFORM 4	110	66	All SZGR 2.0 genes in this pathway
WAKABAYASHI ADIPOGENESIS PPARG RXRA BOUND 36HR	152	88	All SZGR 2.0 genes in this pathway
WAKABAYASHI ADIPOGENESIS PPARG RXRA BOUND 8D	882	506	All SZGR 2.0 genes in this pathway
ZWANG CLASS 3 TRANSIENTLY INDUCED BY EGF	222	159	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
let-7/98	1737	1743	1A	hsa-let-7a^brain	UGAGGUAGUAGGUUGUAUAGUU
				hsa-let-7b^brain	UGAGGUAGUAGGUUGUGUGGUU
				hsa-let-7c^brain	UGAGGUAGUAGGUUGUAUGGUU
				hsa-let-7d^brain	AGAGGUAGUAGGUUGCAUAGU
				hsa-let-7e^brain	UGAGGUAGGAGGUUGUAUAGU
				hsa-let-7f^brain	UGAGGUAGUAGAUUGUAUAGUU
				hsa-miR-98^brain	UGAGGUAGUAAGUUGUAUUGUU
				hsa-let-7g^SZ	UGAGGUAGUAGUUUGUACAGU
				hsa-let-7i^brain	UGAGGUAGUAGUUUGUGCUGU
				hsa-let-7a^brain	UGAGGUAGUAGGUUGUAUAGUU
				hsa-let-7b^brain	UGAGGUAGUAGGUUGUGUGGUU
				hsa-let-7c^brain	UGAGGUAGUAGGUUGUAUGGUU
				hsa-let-7d^brain	AGAGGUAGUAGGUUGCAUAGU
				hsa-let-7e^brain	UGAGGUAGGAGGUUGUAUAGU
				hsa-let-7f^brain	UGAGGUAGUAGAUUGUAUAGUU
				hsa-miR-98^brain	UGAGGUAGUAAGUUGUAUUGUU
				hsa-let-7g^SZ	UGAGGUAGUAGUUUGUACAGU
				hsa-let-7i^brain	UGAGGUAGUAGUUUGUGCUGU
miR-1/206	2024	2030	1A	hsa-miR-1	UGGAAUGUAAAGAAGUAUGUA
				hsa-miR-206^SZ	UGGAAUGUAAGGAAGUGUGUGG
				hsa-miR-613	AGGAAUGUUCCUUCUUUGCC
miR-101	1337	1343	1A	hsa-miR-101	UACAGUACUGUGAUAACUGAAG
miR-130/301	1862	1868	1A	hsa-miR-130a^brain	CAGUGCAAUGUUAAAAGGGCAU
				hsa-miR-301	CAGUGCAAUAGUAUUGUCAAAGC
				hsa-miR-130b^brain	CAGUGCAAUGAUGAAAGGGCAU
				hsa-miR-454-3p	UAGUGCAAUAUUGCUUAUAGGGUUU
miR-141/200a	1548	1554	m8	hsa-miR-141	UAACACUGUCUGGUAAAGAUGG
miR-141/200a	1548	1554	m8	hsa-miR-200a	UAACACUGUCUGGUAACGAUGU
miR-144	1337	1343	1A	hsa-miR-144	UACAGUAUAGAUGAUGUACUAG
miR-145	197	203	1A	hsa-miR-145	GUCCAGUUUUCCCAGGAAUCCCUU
miR-145	197	203	1A	hsa-miR-145	GUCCAGUUUUCCCAGGAAUCCCUU
miR-17-5p/20/93.mr/106/519.d	1770	1776	1A	hsa-miR-17-5p	CAAAGUGCUUACAGUGCAGGUAGU
				hsa-miR-20a^brain	UAAAGUGCUUAUAGUGCAGGUAG
				hsa-miR-106a	AAAAGUGCUUACAGUGCAGGUAGC
				hsa-miR-106b^SZ	UAAAGUGCUGACAGUGCAGAU
				hsa-miR-20b^SZ	CAAAGUGCUCAUAGUGCAGGUAG
				hsa-miR-519d	CAAAGUGCCUCCCUUUAGAGUGU
miR-186	1721	1727	m8	hsa-miR-186	CAAAGAAUUCUCCUUUUGGGCUU
miR-19	442	449	1A,m8	hsa-miR-19a	UGUGCAAAUCUAUGCAAAACUGA
miR-19	442	449	1A,m8	hsa-miR-19b	UGUGCAAAUCCAUGCAAAACUGA
miR-199	385	391	1A	hsa-miR-199a	CCCAGUGUUCAGACUACCUGUUC
miR-199	385	391	1A	hsa-miR-199b	CCCAGUGUUUAGACUAUCUGUUC
miR-200bc/429	1367	1374	1A,m8	hsa-miR-200b	UAAUACUGCCUGGUAAUGAUGAC
				hsa-miR-200c	UAAUACUGCCGGGUAAUGAUGG
				hsa-miR-429	UAAUACUGUCUGGUAAAACCGU
miR-24	2045	2052	1A,m8	hsa-miR-24^SZ	UGGCUCAGUUCAGCAGGAACAG
miR-378	2085	2091	1A	hsa-miR-378	CUCCUGACUCCAGGUCCUGUGU
miR-381	1701	1707	m8	hsa-miR-381	UAUACAAGGGCAAGCUCUCUGU
miR-485-3p	1409	1416	1A,m8	hsa-miR-485-3p	GUCAUACACGGCUCUCCUCUCU
miR-495	1442	1448	1A	hsa-miR-495^brain	AAACAAACAUGGUGCACUUCUUU
miR-539	415	421	1A	hsa-miR-539	GGAGAAAUUAUCCUUGGUGUGU

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: DLC1