Gene Page: LBX1
Summary ?
| GeneID | 10660 |
| Symbol | LBX1 |
| Synonyms | HPX-6|HPX6|LBX1H|homeobox |
| Description | ladybird homeobox 1 |
| Reference | MIM:604255|HGNC:HGNC:16960|HPRD:09178| |
| Gene type | protein-coding |
| Map location | 10q24 |
| Pascal p-value | 0.01 |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 4 |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| ZNF24 | 0.93 | 0.95 |
| USP38 | 0.91 | 0.92 |
| KLHL28 | 0.91 | 0.92 |
| XPO4 | 0.90 | 0.92 |
| CEP97 | 0.90 | 0.91 |
| LMAN1 | 0.90 | 0.92 |
| PPP4R2 | 0.89 | 0.90 |
| ZNF451 | 0.89 | 0.91 |
| SOCS4 | 0.89 | 0.93 |
| ADAM10 | 0.89 | 0.88 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| FXYD1 | -0.62 | -0.66 |
| IFI27 | -0.60 | -0.66 |
| AC018755.7 | -0.60 | -0.63 |
| MT-CO2 | -0.60 | -0.65 |
| AF347015.21 | -0.60 | -0.66 |
| CXCL14 | -0.59 | -0.65 |
| HIGD1B | -0.58 | -0.65 |
| MYL3 | -0.57 | -0.60 |
| AF347015.31 | -0.56 | -0.63 |
| AF347015.8 | -0.56 | -0.62 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0003700 | transcription factor activity | IEA | - | |
| GO:0005515 | protein binding | IEA | - | |
| GO:0043565 | sequence-specific DNA binding | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0048664 | neuron fate determination | IEA | neuron (GO term level: 10) | - |
| GO:0045665 | negative regulation of neuron differentiation | IEA | neuron (GO term level: 10) | - |
| GO:0007519 | skeletal muscle development | IEA | neuron (GO term level: 8) | - |
| GO:0007399 | nervous system development | IEA | neurite (GO term level: 5) | - |
| GO:0001947 | heart looping | IEA | - | |
| GO:0006355 | regulation of transcription, DNA-dependent | IEA | - | |
| GO:0008285 | negative regulation of cell proliferation | IEA | - | |
| GO:0009653 | anatomical structure morphogenesis | TAS | 8645601 | |
| GO:0007275 | multicellular organismal development | IEA | - | |
| GO:0030154 | cell differentiation | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005634 | nucleus | IEA | - | |
| GO:0005667 | transcription factor complex | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| BORCZUK MALIGNANT MESOTHELIOMA DN | 104 | 59 | All SZGR 2.0 genes in this pathway |
| JAZAG TGFB1 SIGNALING VIA SMAD4 UP | 108 | 66 | All SZGR 2.0 genes in this pathway |
| BENPORATH SUZ12 TARGETS | 1038 | 678 | All SZGR 2.0 genes in this pathway |
| BENPORATH EED TARGETS | 1062 | 725 | All SZGR 2.0 genes in this pathway |
| BENPORATH ES WITH H3K27ME3 | 1118 | 744 | All SZGR 2.0 genes in this pathway |
| BENPORATH PRC2 TARGETS | 652 | 441 | All SZGR 2.0 genes in this pathway |
| LEE AGING CEREBELLUM DN | 86 | 66 | All SZGR 2.0 genes in this pathway |
| XU GH1 EXOGENOUS TARGETS DN | 120 | 69 | All SZGR 2.0 genes in this pathway |
| MEISSNER BRAIN HCP WITH H3K27ME3 | 269 | 159 | All SZGR 2.0 genes in this pathway |
| MEISSNER NPC HCP WITH H3K4ME2 AND H3K27ME3 | 349 | 234 | All SZGR 2.0 genes in this pathway |
| MIKKELSEN MCV6 HCP WITH H3K27ME3 | 435 | 318 | All SZGR 2.0 genes in this pathway |
| MIKKELSEN IPS WITH HCP H3K27ME3 | 102 | 76 | All SZGR 2.0 genes in this pathway |
| MIKKELSEN NPC HCP WITH H3K27ME3 | 341 | 243 | All SZGR 2.0 genes in this pathway |
| MIKKELSEN MEF HCP WITH H3K27ME3 | 590 | 403 | All SZGR 2.0 genes in this pathway |
| BRUINS UVC RESPONSE VIA TP53 GROUP D | 280 | 158 | All SZGR 2.0 genes in this pathway |
| ZWANG TRANSIENTLY UP BY 1ST EGF PULSE ONLY | 1839 | 928 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-137 | 165 | 172 | 1A,m8 | hsa-miR-137 | UAUUGCUUAAGAAUACGCGUAG |
| miR-25/32/92/363/367 | 237 | 243 | m8 | hsa-miR-25brain | CAUUGCACUUGUCUCGGUCUGA |
| hsa-miR-32 | UAUUGCACAUUACUAAGUUGC | ||||
| hsa-miR-92 | UAUUGCACUUGUCCCGGCCUG | ||||
| hsa-miR-367 | AAUUGCACUUUAGCAAUGGUGA | ||||
| hsa-miR-92bSZ | UAUUGCACUCGUCCCGGCCUC | ||||
| miR-363 | 236 | 242 | m8 | hsa-miR-363 | AUUGCACGGUAUCCAUCUGUAA |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.