Summary ?
GeneID10814
SymbolCPLX2
Synonyms921-L|CPX-2|CPX2|Hfb1
Descriptioncomplexin 2
ReferenceMIM:605033|HGNC:HGNC:2310|Ensembl:ENSG00000145920|HPRD:09234|Vega:OTTHUMG00000130665
Gene typeprotein-coding
Map location5q35.2
Pascal p-value0.245
Sherlock p-value0.944
Fetal beta-2.293
DMG1 (# studies)
eGeneMeta
SupportEXOCYTOSIS
CompositeSet
Darnell FMRP targets

Gene in Data Sources
Gene set name Method of gene setDescriptionInfo
CV:PGCnpGenome-wide Association StudyGWAS
DMG:Wockner_2014Genome-wide DNA methylation analysisThis dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). 1
PMID:cooccurHigh-throughput literature-searchSystematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
AssociationA combined odds ratio method (Sun et al. 2008), association studies1Link to SZGene
GSMA_IIAGenome scan meta-analysis (All samples)Psr: 0.0276 
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophreniasClick to show details
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 3 

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

ProbeChromosomePositionNearest geneP (dis)Beta (dis)FDR (dis)Study
cg086703835175257943CPLX24.387E-40.4720.045DMG:Wockner_2014


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
GenePearson's Correlation Spearman's Correlation
SEC23B0.900.89
C5orf150.880.87
TSN0.880.87
USP380.880.87
SURF40.880.84
TICAM20.870.89
TMED70.870.89
GOLPH30.870.87
COPB20.860.85
DCTN40.860.87
Top 10 negatively co-expressed genes
GenePearson's Correlation Spearman's Correlation
AF347015.21-0.68-0.67
MT-CO2-0.67-0.69
AF347015.8-0.65-0.68
AF347015.33-0.63-0.65
AF347015.31-0.63-0.66
AC098691.2-0.62-0.63
MT-CYB-0.62-0.65
AF347015.27-0.61-0.65
FXYD1-0.60-0.63
AF347015.18-0.60-0.68

Section III. Gene Ontology annotation

Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0019905syntaxin bindingIEASynap (GO term level: 5)-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0043303mast cell degranulationIEAserotonin (GO term level: 9)-
GO:0006836neurotransmitter transportIEAneuron, Neurotransmitter (GO term level: 5)-
GO:0006904vesicle docking during exocytosisTAS7553862 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005737cytoplasmIEA-

Section V. Pathway annotation

Pathway namePathway size# SZGR 2.0 genes in pathwayInfo
TOMIDA METASTASIS UP 2613All SZGR 2.0 genes in this pathway
PATIL LIVER CANCER 747453All SZGR 2.0 genes in this pathway
PASQUALUCCI LYMPHOMA BY GC STAGE DN 165104All SZGR 2.0 genes in this pathway
STARK PREFRONTAL CORTEX 22Q11 DELETION UP 195138All SZGR 2.0 genes in this pathway
MORI EMU MYC LYMPHOMA BY ONSET TIME UP 11069All SZGR 2.0 genes in this pathway
LEE CALORIE RESTRICTION MUSCLE DN 5128All SZGR 2.0 genes in this pathway
WANG LSD1 TARGETS DN 3930All SZGR 2.0 genes in this pathway
ACEVEDO LIVER CANCER WITH H3K27ME3 DN 228114All SZGR 2.0 genes in this pathway
ACEVEDO METHYLATED IN LIVER CANCER DN 940425All SZGR 2.0 genes in this pathway
ZHENG GLIOBLASTOMA PLASTICITY UP 250168All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS UP 1305895All SZGR 2.0 genes in this pathway
MILI PSEUDOPODIA CHEMOTAXIS UP 7445All SZGR 2.0 genes in this pathway
JISON SICKLE CELL DISEASE UP 181106All SZGR 2.0 genes in this pathway
MEISSNER NPC HCP WITH H3K4ME2 491319All SZGR 2.0 genes in this pathway
MIKKELSEN MEF HCP WITH H3K27ME3 590403All SZGR 2.0 genes in this pathway
PILON KLF1 TARGETS DN 19721213All SZGR 2.0 genes in this pathway
LEE BMP2 TARGETS UP 745475All SZGR 2.0 genes in this pathway
TORCHIA TARGETS OF EWSR1 FLI1 FUSION UP 271165All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-1/2063573641A,m8hsa-miR-1UGGAAUGUAAAGAAGUAUGUA
hsa-miR-206SZUGGAAUGUAAGGAAGUGUGUGG
hsa-miR-613AGGAAUGUUCCUUCUUUGCC
hsa-miR-1UGGAAUGUAAAGAAGUAUGUA
hsa-miR-206SZUGGAAUGUAAGGAAGUGUGUGG
hsa-miR-613AGGAAUGUUCCUUCUUUGCC
miR-135192719341A,m8hsa-miR-135aUAUGGCUUUUUAUUCCUAUGUGA
hsa-miR-135bUAUGGCUUUUCAUUCCUAUGUG
hsa-miR-135aUAUGGCUUUUUAUUCCUAUGUGA
hsa-miR-135bUAUGGCUUUUCAUUCCUAUGUG
hsa-miR-135aUAUGGCUUUUUAUUCCUAUGUGA
hsa-miR-135bUAUGGCUUUUCAUUCCUAUGUG
miR-190193119371Ahsa-miR-190UGAUAUGUUUGAUAUAUUAGGU
miR-32625392545m8hsa-miR-326CCUCUGGGCCCUUCCUCCAG
miR-33122652271m8hsa-miR-331brainGCCCCUGGGCCUAUCCUAGAA
miR-34/4497367431A,m8hsa-miR-34abrainUGGCAGUGUCUUAGCUGGUUGUU
hsa-miR-34cAGGCAGUGUAGUUAGCUGAUUGC
hsa-miR-449UGGCAGUGUAUUGUUAGCUGGU
hsa-miR-449bAGGCAGUGUAUUGUUAGCUGGC
hsa-miR-34abrainUGGCAGUGUCUUAGCUGGUUGUU
hsa-miR-34cAGGCAGUGUAGUUAGCUGAUUGC
hsa-miR-449UGGCAGUGUAUUGUUAGCUGGU
hsa-miR-449bAGGCAGUGUAUUGUUAGCUGGC
miR-485-3p39103916m8hsa-miR-485-3pGUCAUACACGGCUCUCCUCUCU