Gene Page: DBF4
Summary ?
GeneID | 10926 |
Symbol | DBF4 |
Synonyms | ASK|CHIF|DBF4A|ZDBF1 |
Description | DBF4 zinc finger |
Reference | MIM:604281|HGNC:HGNC:17364|Ensembl:ENSG00000006634|HPRD:10371|Vega:OTTHUMG00000131034 |
Gene type | protein-coding |
Map location | 7q21.3 |
Pascal p-value | 0.008 |
Sherlock p-value | 0.088 |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
Network | Shortest path distance of core genes in the Human protein-protein interaction network | Contribution to shortest path in PPI network: 0.0214 |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0003676 | nucleic acid binding | IEA | - | |
GO:0005515 | protein binding | IPI | 15231747 | |
GO:0008270 | zinc ion binding | IEA | - | |
GO:0008047 | enzyme activator activity | TAS | 10373557 | |
GO:0046872 | metal ion binding | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0000082 | G1/S transition of mitotic cell cycle | TAS | 10373557 | |
GO:0006260 | DNA replication | EXP | 12791985 | |
GO:0006260 | DNA replication | TAS | 10373557 | |
GO:0007049 | cell cycle | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005622 | intracellular | IEA | - | |
GO:0005634 | nucleus | IEA | - | |
GO:0005654 | nucleoplasm | EXP | 10846177 |15226314 |15707391 |
Section IV. Protein-protein interaction annotation
Interactors | Aliases B | Official full name B | Experimental | Source | PubMed ID |
---|---|---|---|---|---|
CDC7 | CDC7L1 | HsCDC7 | Hsk1 | MGC117361 | MGC126237 | MGC126238 | huCDC7 | cell division cycle 7 homolog (S. cerevisiae) | - | HPRD | 10373557|10523313 |12614612 |
CDC7 | CDC7L1 | HsCDC7 | Hsk1 | MGC117361 | MGC126237 | MGC126238 | huCDC7 | cell division cycle 7 homolog (S. cerevisiae) | HsCdc7 interacts with HsDbf4. | BIND | 10523313 |
CDC7 | CDC7L1 | HsCDC7 | Hsk1 | MGC117361 | MGC126237 | MGC126238 | huCDC7 | cell division cycle 7 homolog (S. cerevisiae) | Affinity Capture-Western in vivo Reconstituted Complex Two-hybrid | BioGRID | 10373557 |10523313 |12614612 |
CHEK2 | CDS1 | CHK2 | HuCds1 | LFS2 | PP1425 | RAD53 | CHK2 checkpoint homolog (S. pombe) | - | HPRD,BioGRID | 12441400 |
LSM8 | YJR022W | LSM8 homolog, U6 small nuclear RNA associated (S. cerevisiae) | Two-hybrid | BioGRID | 15231747 |
MCM2 | BM28 | CCNL1 | CDCL1 | D3S3194 | KIAA0030 | MGC10606 | MITOTIN | cdc19 | minichromosome maintenance complex component 2 | - | HPRD,BioGRID | 12614612 |
MCM3 | HCC5 | MGC1157 | P1-MCM3 | P1.h | RLFB | minichromosome maintenance complex component 3 | - | HPRD,BioGRID | 12614612 |
MCM4 | CDC21 | CDC54 | MGC33310 | P1-CDC21 | hCdc21 | minichromosome maintenance complex component 4 | Two-hybrid | BioGRID | 12614612 |
MCM7 | CDABP0042 | CDC47 | MCM2 | P1.1-MCM3 | P1CDC47 | P85MCM | PNAS-146 | minichromosome maintenance complex component 7 | - | HPRD,BioGRID | 12614612 |
MEN1 | MEAI | SCG2 | multiple endocrine neoplasia I | Menin interacts with ASK. | BIND | 15374998 |
ORC1L | HSORC1 | ORC1 | PARC1 | origin recognition complex, subunit 1-like (yeast) | Two-hybrid | BioGRID | 12614612 |
ORC2L | ORC2 | origin recognition complex, subunit 2-like (yeast) | - | HPRD,BioGRID | 12614612 |
ORC4L | ORC4 | ORC4P | origin recognition complex, subunit 4-like (yeast) | Affinity Capture-Western | BioGRID | 12614612 |
ORC5L | ORC5 | ORC5P | ORC5T | origin recognition complex, subunit 5-like (yeast) | Two-hybrid | BioGRID | 12614612 |
ORC6L | ORC6 | origin recognition complex, subunit 6 like (yeast) | Affinity Capture-Western Two-hybrid | BioGRID | 12614612 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG CELL CYCLE | 128 | 84 | All SZGR 2.0 genes in this pathway |
REACTOME ACTIVATION OF THE PRE REPLICATIVE COMPLEX | 31 | 16 | All SZGR 2.0 genes in this pathway |
REACTOME CELL CYCLE | 421 | 253 | All SZGR 2.0 genes in this pathway |
REACTOME CELL CYCLE MITOTIC | 325 | 185 | All SZGR 2.0 genes in this pathway |
REACTOME CELL CYCLE CHECKPOINTS | 124 | 70 | All SZGR 2.0 genes in this pathway |
REACTOME M G1 TRANSITION | 81 | 45 | All SZGR 2.0 genes in this pathway |
REACTOME G1 S TRANSITION | 112 | 63 | All SZGR 2.0 genes in this pathway |
REACTOME MITOTIC G1 G1 S PHASES | 137 | 79 | All SZGR 2.0 genes in this pathway |
REACTOME MITOTIC M M G1 PHASES | 172 | 98 | All SZGR 2.0 genes in this pathway |
REACTOME DNA REPLICATION | 192 | 110 | All SZGR 2.0 genes in this pathway |
REACTOME ACTIVATION OF ATR IN RESPONSE TO REPLICATION STRESS | 38 | 18 | All SZGR 2.0 genes in this pathway |
REACTOME G2 M CHECKPOINTS | 45 | 23 | All SZGR 2.0 genes in this pathway |
SENGUPTA NASOPHARYNGEAL CARCINOMA UP | 294 | 178 | All SZGR 2.0 genes in this pathway |
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP | 1382 | 904 | All SZGR 2.0 genes in this pathway |
NEWMAN ERCC6 TARGETS UP | 26 | 18 | All SZGR 2.0 genes in this pathway |
ODONNELL TFRC TARGETS DN | 139 | 76 | All SZGR 2.0 genes in this pathway |
ODONNELL TARGETS OF MYC AND TFRC DN | 45 | 25 | All SZGR 2.0 genes in this pathway |
TIEN INTESTINE PROBIOTICS 24HR UP | 557 | 331 | All SZGR 2.0 genes in this pathway |
KINSEY TARGETS OF EWSR1 FLII FUSION UP | 1278 | 748 | All SZGR 2.0 genes in this pathway |
KIM WT1 TARGETS DN | 459 | 276 | All SZGR 2.0 genes in this pathway |
KIM WT1 TARGETS 12HR DN | 209 | 122 | All SZGR 2.0 genes in this pathway |
BIDUS METASTASIS UP | 214 | 134 | All SZGR 2.0 genes in this pathway |
DODD NASOPHARYNGEAL CARCINOMA DN | 1375 | 806 | All SZGR 2.0 genes in this pathway |
RODRIGUES THYROID CARCINOMA POORLY DIFFERENTIATED UP | 633 | 376 | All SZGR 2.0 genes in this pathway |
RODRIGUES THYROID CARCINOMA ANAPLASTIC UP | 722 | 443 | All SZGR 2.0 genes in this pathway |
ENK UV RESPONSE EPIDERMIS DN | 508 | 354 | All SZGR 2.0 genes in this pathway |
LINDGREN BLADDER CANCER CLUSTER 3 UP | 329 | 196 | All SZGR 2.0 genes in this pathway |
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN | 1781 | 1082 | All SZGR 2.0 genes in this pathway |
TANG SENESCENCE TP53 TARGETS DN | 57 | 33 | All SZGR 2.0 genes in this pathway |
HAMAI APOPTOSIS VIA TRAIL UP | 584 | 356 | All SZGR 2.0 genes in this pathway |
ROSTY CERVICAL CANCER PROLIFERATION CLUSTER | 140 | 73 | All SZGR 2.0 genes in this pathway |
DACOSTA UV RESPONSE VIA ERCC3 DN | 855 | 609 | All SZGR 2.0 genes in this pathway |
PUJANA BRCA1 PCC NETWORK | 1652 | 1023 | All SZGR 2.0 genes in this pathway |
PUJANA BRCA2 PCC NETWORK | 423 | 265 | All SZGR 2.0 genes in this pathway |
PUJANA CHEK2 PCC NETWORK | 779 | 480 | All SZGR 2.0 genes in this pathway |
BUYTAERT PHOTODYNAMIC THERAPY STRESS DN | 637 | 377 | All SZGR 2.0 genes in this pathway |
FERREIRA EWINGS SARCOMA UNSTABLE VS STABLE UP | 167 | 92 | All SZGR 2.0 genes in this pathway |
BENPORATH PROLIFERATION | 147 | 80 | All SZGR 2.0 genes in this pathway |
BASSO B LYMPHOCYTE NETWORK | 143 | 96 | All SZGR 2.0 genes in this pathway |
MANALO HYPOXIA DN | 289 | 166 | All SZGR 2.0 genes in this pathway |
BYSTRYKH HEMATOPOIESIS STEM CELL FLI1 | 9 | 8 | All SZGR 2.0 genes in this pathway |
REN BOUND BY E2F | 61 | 40 | All SZGR 2.0 genes in this pathway |
MOREAUX MULTIPLE MYELOMA BY TACI DN | 172 | 107 | All SZGR 2.0 genes in this pathway |
KAMMINGA EZH2 TARGETS | 41 | 26 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE INCIPIENT UP | 390 | 242 | All SZGR 2.0 genes in this pathway |
SU TESTIS | 76 | 53 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 8HR UP | 105 | 73 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE UP | 1691 | 1088 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 14HR UP | 156 | 101 | All SZGR 2.0 genes in this pathway |
YAMAZAKI TCEB3 TARGETS DN | 215 | 132 | All SZGR 2.0 genes in this pathway |
XU GH1 AUTOCRINE TARGETS UP | 268 | 157 | All SZGR 2.0 genes in this pathway |
XU GH1 EXOGENOUS TARGETS DN | 120 | 69 | All SZGR 2.0 genes in this pathway |
MARSON BOUND BY FOXP3 STIMULATED | 1022 | 619 | All SZGR 2.0 genes in this pathway |
MARSON BOUND BY FOXP3 UNSTIMULATED | 1229 | 713 | All SZGR 2.0 genes in this pathway |
ZHENG FOXP3 TARGETS IN THYMUS UP | 196 | 137 | All SZGR 2.0 genes in this pathway |
ZHANG BREAST CANCER PROGENITORS UP | 425 | 253 | All SZGR 2.0 genes in this pathway |
ZHENG GLIOBLASTOMA PLASTICITY UP | 250 | 168 | All SZGR 2.0 genes in this pathway |
WHITEFORD PEDIATRIC CANCER MARKERS | 116 | 63 | All SZGR 2.0 genes in this pathway |
FIRESTEIN PROLIFERATION | 175 | 125 | All SZGR 2.0 genes in this pathway |
HOFFMANN LARGE TO SMALL PRE BII LYMPHOCYTE UP | 163 | 102 | All SZGR 2.0 genes in this pathway |
SHEDDEN LUNG CANCER POOR SURVIVAL A6 | 456 | 285 | All SZGR 2.0 genes in this pathway |
ZHANG TLX TARGETS 60HR DN | 277 | 166 | All SZGR 2.0 genes in this pathway |
COLINA TARGETS OF 4EBP1 AND 4EBP2 | 356 | 214 | All SZGR 2.0 genes in this pathway |
ISHIDA E2F TARGETS | 53 | 27 | All SZGR 2.0 genes in this pathway |
BOYAULT LIVER CANCER SUBCLASS G23 UP | 52 | 35 | All SZGR 2.0 genes in this pathway |
KOBAYASHI EGFR SIGNALING 24HR DN | 251 | 151 | All SZGR 2.0 genes in this pathway |
FOURNIER ACINAR DEVELOPMENT LATE 2 | 277 | 172 | All SZGR 2.0 genes in this pathway |
CAIRO HEPATOBLASTOMA CLASSES UP | 605 | 377 | All SZGR 2.0 genes in this pathway |
WONG EMBRYONIC STEM CELL CORE | 335 | 193 | All SZGR 2.0 genes in this pathway |
GREGORY SYNTHETIC LETHAL WITH IMATINIB | 145 | 83 | All SZGR 2.0 genes in this pathway |
PILON KLF1 TARGETS DN | 1972 | 1213 | All SZGR 2.0 genes in this pathway |
JOHNSTONE PARVB TARGETS 3 DN | 918 | 550 | All SZGR 2.0 genes in this pathway |
LEE BMP2 TARGETS DN | 882 | 538 | All SZGR 2.0 genes in this pathway |
GOBERT OLIGODENDROCYTE DIFFERENTIATION UP | 570 | 339 | All SZGR 2.0 genes in this pathway |
RAO BOUND BY SALL4 ISOFORM B | 517 | 302 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-30-3p | 270 | 277 | 1A,m8 | hsa-miR-30a-3p | CUUUCAGUCGGAUGUUUGCAGC |
hsa-miR-30e-3p | CUUUCAGUCGGAUGUUUACAGC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.