Gene Page: HNRNPA0
Summary ?
| GeneID | 10949 |
| Symbol | HNRNPA0 |
| Synonyms | HNRPA0 |
| Description | heterogeneous nuclear ribonucleoprotein A0 |
| Reference | MIM:609409|HGNC:HGNC:5030|HPRD:17112| |
| Gene type | protein-coding |
| Map location | 5q31 |
| Pascal p-value | 7.298E-4 |
| Sherlock p-value | 0.289 |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| GSMA_I | Genome scan meta-analysis | Psr: 0.0032 |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| C22orf30 | 0.94 | 0.94 |
| RNF4 | 0.93 | 0.93 |
| FAM120B | 0.93 | 0.94 |
| VPS39 | 0.93 | 0.93 |
| DNAJC14 | 0.92 | 0.91 |
| KIAA1409 | 0.92 | 0.93 |
| ZRANB1 | 0.92 | 0.93 |
| ADAR | 0.92 | 0.92 |
| ANKRD17 | 0.92 | 0.91 |
| EXOC7 | 0.92 | 0.92 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| AF347015.21 | -0.79 | -0.84 |
| MT-CO2 | -0.79 | -0.78 |
| AF347015.31 | -0.79 | -0.78 |
| AF347015.8 | -0.77 | -0.78 |
| FXYD1 | -0.76 | -0.77 |
| HIGD1B | -0.76 | -0.78 |
| IFI27 | -0.75 | -0.76 |
| AF347015.33 | -0.75 | -0.73 |
| MT-CYB | -0.75 | -0.73 |
| AF347015.27 | -0.74 | -0.75 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0000166 | nucleotide binding | IEA | - | |
| GO:0003723 | RNA binding | TAS | 7585247 | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0000398 | nuclear mRNA splicing, via spliceosome | EXP | 12226669 | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005634 | nucleus | TAS | 7585247 | |
| GO:0030530 | heterogeneous nuclear ribonucleoprotein complex | TAS | 7585247 |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| REACTOME PROCESSING OF CAPPED INTRON CONTAINING PRE MRNA | 140 | 77 | All SZGR 2.0 genes in this pathway |
| REACTOME MRNA PROCESSING | 161 | 86 | All SZGR 2.0 genes in this pathway |
| REACTOME MRNA SPLICING | 111 | 58 | All SZGR 2.0 genes in this pathway |
| PRAMOONJAGO SOX4 TARGETS DN | 51 | 35 | All SZGR 2.0 genes in this pathway |
| DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP | 1382 | 904 | All SZGR 2.0 genes in this pathway |
| RHEIN ALL GLUCOCORTICOID THERAPY DN | 362 | 238 | All SZGR 2.0 genes in this pathway |
| TIEN INTESTINE PROBIOTICS 24HR UP | 557 | 331 | All SZGR 2.0 genes in this pathway |
| ENK UV RESPONSE KERATINOCYTE DN | 485 | 334 | All SZGR 2.0 genes in this pathway |
| SCHLOSSER SERUM RESPONSE DN | 712 | 443 | All SZGR 2.0 genes in this pathway |
| WOOD EBV EBNA1 TARGETS UP | 110 | 71 | All SZGR 2.0 genes in this pathway |
| NUYTTEN NIPP1 TARGETS DN | 848 | 527 | All SZGR 2.0 genes in this pathway |
| SCHAEFFER PROSTATE DEVELOPMENT 6HR DN | 514 | 330 | All SZGR 2.0 genes in this pathway |
| LIN APC TARGETS | 77 | 55 | All SZGR 2.0 genes in this pathway |
| NING CHRONIC OBSTRUCTIVE PULMONARY DISEASE UP | 157 | 105 | All SZGR 2.0 genes in this pathway |
| MODY HIPPOCAMPUS PRENATAL | 42 | 33 | All SZGR 2.0 genes in this pathway |
| JIANG HYPOXIA CANCER | 83 | 52 | All SZGR 2.0 genes in this pathway |
| CREIGHTON ENDOCRINE THERAPY RESISTANCE 1 | 528 | 324 | All SZGR 2.0 genes in this pathway |
| MASSARWEH TAMOXIFEN RESISTANCE DN | 258 | 160 | All SZGR 2.0 genes in this pathway |
| HOFFMANN LARGE TO SMALL PRE BII LYMPHOCYTE DN | 72 | 47 | All SZGR 2.0 genes in this pathway |
| BOYAULT LIVER CANCER SUBCLASS G1 UP | 113 | 70 | All SZGR 2.0 genes in this pathway |
| CHIANG LIVER CANCER SUBCLASS UNANNOTATED DN | 193 | 112 | All SZGR 2.0 genes in this pathway |
| MARTENS TRETINOIN RESPONSE DN | 841 | 431 | All SZGR 2.0 genes in this pathway |
| KIM ALL DISORDERS CALB1 CORR UP | 548 | 370 | All SZGR 2.0 genes in this pathway |
| PILON KLF1 TARGETS DN | 1972 | 1213 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-194 | 227 | 233 | 1A | hsa-miR-194 | UGUAACAGCAACUCCAUGUGGA |
| miR-221/222 | 353 | 359 | 1A | hsa-miR-221brain | AGCUACAUUGUCUGCUGGGUUUC |
| hsa-miR-222brain | AGCUACAUCUGGCUACUGGGUCUC | ||||
| hsa-miR-221brain | AGCUACAUUGUCUGCUGGGUUUC | ||||
| hsa-miR-222brain | AGCUACAUCUGGCUACUGGGUCUC | ||||
| miR-25/32/92/363/367 | 1448 | 1454 | 1A | hsa-miR-25brain | CAUUGCACUUGUCUCGGUCUGA |
| hsa-miR-32 | UAUUGCACAUUACUAAGUUGC | ||||
| hsa-miR-92 | UAUUGCACUUGUCCCGGCCUG | ||||
| hsa-miR-367 | AAUUGCACUUUAGCAAUGGUGA | ||||
| hsa-miR-92bSZ | UAUUGCACUCGUCCCGGCCUC | ||||
| miR-376 | 433 | 440 | 1A,m8 | hsa-miR-376a | AUCAUAGAGGAAAAUCCACGU |
| hsa-miR-376b | AUCAUAGAGGAAAAUCCAUGUU | ||||
| miR-491 | 208 | 214 | 1A | hsa-miR-491brain | AGUGGGGAACCCUUCCAUGAGGA |
| miR-493-5p | 477 | 484 | 1A,m8 | hsa-miR-493-5p | UUGUACAUGGUAGGCUUUCAUU |
| miR-496 | 1295 | 1301 | 1A | hsa-miR-496 | AUUACAUGGCCAAUCUC |
| miR-500 | 1377 | 1384 | 1A,m8 | hsa-miR-500 | AUGCACCUGGGCAAGGAUUCUG |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.