Summary ?
GeneID10981
SymbolRAB32
Synonyms-
DescriptionRAB32, member RAS oncogene family
ReferenceMIM:612906|HGNC:HGNC:9772|Ensembl:ENSG00000118508|HPRD:06700|Vega:OTTHUMG00000015755
Gene typeprotein-coding
Map location6q24.3
Pascal p-value0.224
Fetal beta0.495
DMG1 (# studies)
eGeneMyers' cis & trans

Gene in Data Sources
Gene set name Method of gene setDescriptionInfo
CV:PGCnpGenome-wide Association StudyGWAS
DMG:vanEijk_2014Genome-wide DNA methylation analysisThis dataset includes 432 differentially methylated CpG sites corresponding to 391 unique transcripts between schizophrenia patients (n=260) and unaffected controls (n=250). 1

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

ProbeChromosomePositionNearest geneP (dis)Beta (dis)FDR (dis)Study
cg041130756146865487RAB321.113E-4-4.623DMG:vanEijk_2014

@eQTL annotation

SNP IDChromosomePositioneGeneGene Entrez IDpvalueqvalueTSS distanceeQTL type
rs2469564chr1576489954RAB32109810.14trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
GenePearson's Correlation Spearman's Correlation
PEX140.830.82
LONP10.820.83
ARFRP10.820.80
MIB20.820.79
ANAPC20.820.81
DAPK30.810.81
PICK10.810.80
POLR2E0.810.80
THAP40.800.80
DDX410.790.78
Top 10 negatively co-expressed genes
GenePearson's Correlation Spearman's Correlation
AF347015.21-0.67-0.62
AF347015.31-0.66-0.61
MT-CO2-0.63-0.59
MT-CYB-0.61-0.56
AF347015.33-0.59-0.54
AF347015.8-0.59-0.55
AF347015.27-0.59-0.58
AF347015.2-0.59-0.53
CLEC2B-0.58-0.55
HIGD1B-0.58-0.54

Section III. Gene Ontology annotation

Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0000166nucleotide bindingIEA-
GO:0005524ATP bindingIEA-
GO:0005525GTP bindingIEA-
GO:0004672protein kinase activityIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006468protein amino acid phosphorylationIEA-
GO:0007264small GTPase mediated signal transductionIEA-
GO:0015031protein transportIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005739mitochondrionIEA-

Section V. Pathway annotation

Pathway namePathway size# SZGR 2.0 genes in pathwayInfo
DAVICIONI MOLECULAR ARMS VS ERMS DN 182111All SZGR 2.0 genes in this pathway
DAVICIONI TARGETS OF PAX FOXO1 FUSIONS UP 255177All SZGR 2.0 genes in this pathway
BORCZUK MALIGNANT MESOTHELIOMA UP 305185All SZGR 2.0 genes in this pathway
RODRIGUES THYROID CARCINOMA ANAPLASTIC UP 722443All SZGR 2.0 genes in this pathway
WANG RESPONSE TO BEXAROTENE DN 2919All SZGR 2.0 genes in this pathway
BENPORATH EED TARGETS 1062725All SZGR 2.0 genes in this pathway
TARTE PLASMA CELL VS PLASMABLAST UP 398262All SZGR 2.0 genes in this pathway
YAGI AML RELAPSE PROGNOSIS 3524All SZGR 2.0 genes in this pathway
HALMOS CEBPA TARGETS UP 5234All SZGR 2.0 genes in this pathway
YAGI AML SURVIVAL 12987All SZGR 2.0 genes in this pathway
REN ALVEOLAR RHABDOMYOSARCOMA DN 408274All SZGR 2.0 genes in this pathway
IVANOVA HEMATOPOIESIS LATE PROGENITOR 544307All SZGR 2.0 genes in this pathway
KRIGE RESPONSE TO TOSEDOSTAT 6HR UP 953554All SZGR 2.0 genes in this pathway
KRIGE RESPONSE TO TOSEDOSTAT 24HR DN 1011592All SZGR 2.0 genes in this pathway
FOSTER TOLERANT MACROPHAGE UP 15692All SZGR 2.0 genes in this pathway
MCGARVEY SILENCED BY METHYLATION IN COLON CANCER 4229All SZGR 2.0 genes in this pathway
BREDEMEYER RAG SIGNALING NOT VIA ATM UP 6229All SZGR 2.0 genes in this pathway
BLUM RESPONSE TO SALIRASIB UP 245159All SZGR 2.0 genes in this pathway
LEE LIVER CANCER SURVIVAL DN 175103All SZGR 2.0 genes in this pathway
BOYLAN MULTIPLE MYELOMA C D DN 252155All SZGR 2.0 genes in this pathway
YAMANAKA GLIOBLASTOMA SURVIVAL UP 117All SZGR 2.0 genes in this pathway
KAMIKUBO MYELOID MN1 NETWORK 1914All SZGR 2.0 genes in this pathway
VERHAAK GLIOBLASTOMA MESENCHYMAL 216130All SZGR 2.0 genes in this pathway
PILON KLF1 TARGETS DN 19721213All SZGR 2.0 genes in this pathway
LEE BMP2 TARGETS DN 882538All SZGR 2.0 genes in this pathway
ACEVEDO FGFR1 TARGETS IN PROSTATE CANCER MODEL UP 289184All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-30-5p2382451A,m8hsa-miR-30a-5pUGUAAACAUCCUCGACUGGAAG
hsa-miR-30cbrainUGUAAACAUCCUACACUCUCAGC
hsa-miR-30dSZUGUAAACAUCCCCGACUGGAAG
hsa-miR-30bSZUGUAAACAUCCUACACUCAGCU
hsa-miR-30e-5pUGUAAACAUCCUUGACUGGA