Summary ?
GeneID11143
SymbolKAT7
SynonymsHBO1|HBOA|MYST2|ZC2HC7
Descriptionlysine acetyltransferase 7
ReferenceMIM:609880|HGNC:HGNC:17016|Ensembl:ENSG00000136504|HPRD:07135|Vega:OTTHUMG00000161770
Gene typeprotein-coding
Map location17q21.32
Pascal p-value0.024
Sherlock p-value0.168

Gene in Data Sources
Gene set name Method of gene setDescriptionInfo
CV:PGCnpGenome-wide Association StudyGWAS

Section I. Genetics and epigenetics annotation

@eQTL annotation

SNP IDChromosomePositioneGeneGene Entrez IDpvalueqvalueTSS distanceeQTL type
rs3217906chr124405803MYST2111430.19trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0003700transcription factor activityIEA-
GO:0005515protein bindingIPI10930412 |15383276 |16169070 
GO:0004406H3/H4 histone acetyltransferase activityTAS10438470 
GO:0016740transferase activityIEA-
GO:0008270zinc ion bindingIEA-
GO:0008415acyltransferase activityIEA-
GO:0046872metal ion bindingIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006355regulation of transcription, DNA-dependentTAS10438470 
GO:0006350transcriptionIEA-
GO:0006260DNA replicationTAS10438470 
GO:0016568chromatin modificationIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005622intracellularIEA-
GO:0005634nucleusTAS10438470 

Section IV. Protein-protein interaction annotation

InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
ARAIS | DHTR | HUMARA | KD | NR3C4 | SBMA | SMAX1 | TFMandrogen receptor-HPRD,BioGRID10930412 
ATN1B37 | D12S755E | DRPLA | NODatrophin 1Two-hybridBioGRID16169070 
C15orf29FLJ22557 | MGC117356chromosome 15 open reading frame 29Two-hybridBioGRID16169070 
C9orf82FLJ13657 | RP11-337A23.1chromosome 9 open reading frame 82Two-hybridBioGRID16169070 
CALCOCO2MGC17318 | NDP52calcium binding and coiled-coil domain 2Two-hybridBioGRID16189514 
CBX8HPC3 | PC3 | RC1chromobox homolog 8 (Pc class homolog, Drosophila)Two-hybridBioGRID16169070 
CEP70BITE | FLJ13036centrosomal protein 70kDaTwo-hybridBioGRID16189514 
DDX11CHL1 | CHLR1 | KRG2 | MGC133249 | MGC9335DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11 (CHL1-like helicase homolog, S. cerevisiae)Two-hybridBioGRID16169070 
DVL3KIAA0208dishevelled, dsh homolog 3 (Drosophila)Two-hybridBioGRID16189514 
HOOK2FLJ26218 | HK2hook homolog 2 (Drosophila)Two-hybridBioGRID16189514 
KCTD13FKSG86 | PDIP1 | POLDIP1potassium channel tetramerisation domain containing 13Two-hybridBioGRID16189514 
ORC1LHSORC1 | ORC1 | PARC1origin recognition complex, subunit 1-like (yeast)-HPRD,BioGRID10438470 
PACSIN1KIAA1379 | SDPIprotein kinase C and casein kinase substrate in neurons 1Two-hybridBioGRID16169070 
POLBMGC125976polymerase (DNA directed), betaTwo-hybridBioGRID16169070 
PPIDCYP-40 | CYPD | MGC33096peptidylprolyl isomerase DTwo-hybridBioGRID16169070 
RGL2HKE1.5 | KE1.5 | RAB2Lral guanine nucleotide dissociation stimulator-like 2Two-hybridBioGRID16169070 
RP4-691N24.1FLJ11792 | KIAA0980 | NLP | dJ691N24.1ninein-likeTwo-hybridBioGRID16189514 
RPS10MGC88819ribosomal protein S10Two-hybridBioGRID16169070 
SAT1DC21 | KFSD | SAT | SSAT | SSAT-1spermidine/spermine N1-acetyltransferase 1Two-hybridBioGRID16169070 
SEPT5CDCREL | CDCREL-1 | CDCREL1 | H5 | PNUTL1septin 5Two-hybridBioGRID16169070 
SNAPINSNAPAPSNAP-associated proteinTwo-hybridBioGRID16169070 
VIMFLJ36605vimentinTwo-hybridBioGRID16169070 |16189514 
WDR33FLJ11294 | WDC146WD repeat domain 33Two-hybridBioGRID16169070 
ZBTB8BOZF1 | FLJ90065 | MGC17919zinc finger and BTB domain containing 8Two-hybridBioGRID16189514 
ZNF165LD65 | ZSCAN7zinc finger protein 165Two-hybridBioGRID16189514 


Section V. Pathway annotation

Pathway namePathway size# SZGR 2.0 genes in pathwayInfo
PID AR TF PATHWAY 5338All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN 17811082All SZGR 2.0 genes in this pathway
GAUSSMANN MLL AF4 FUSION TARGETS A UP 191128All SZGR 2.0 genes in this pathway
RICKMAN TUMOR DIFFERENTIATED WELL VS MODERATELY UP 10969All SZGR 2.0 genes in this pathway
BENPORATH ES 1 379235All SZGR 2.0 genes in this pathway
KAUFFMANN DNA REPLICATION GENES 14787All SZGR 2.0 genes in this pathway
NIKOLSKY BREAST CANCER 17Q21 Q25 AMPLICON 335181All SZGR 2.0 genes in this pathway
MARIADASON RESPONSE TO CURCUMIN SULINDAC 7 1910All SZGR 2.0 genes in this pathway
GAVIN FOXP3 TARGETS CLUSTER P3 160103All SZGR 2.0 genes in this pathway
MARTINEZ RB1 TARGETS UP 673430All SZGR 2.0 genes in this pathway
MARTINEZ TP53 TARGETS DN 593372All SZGR 2.0 genes in this pathway
MARTINEZ RB1 AND TP53 TARGETS DN 591366All SZGR 2.0 genes in this pathway
TOYOTA TARGETS OF MIR34B AND MIR34C 463262All SZGR 2.0 genes in this pathway
MUELLER PLURINET 299189All SZGR 2.0 genes in this pathway
AGUIRRE PANCREATIC CANCER COPY NUMBER UP 298174All SZGR 2.0 genes in this pathway
HAN SATB1 TARGETS UP 395249All SZGR 2.0 genes in this pathway
VERHAAK GLIOBLASTOMA PRONEURAL 177132All SZGR 2.0 genes in this pathway
WAKABAYASHI ADIPOGENESIS PPARG RXRA BOUND 8D 882506All SZGR 2.0 genes in this pathway
DELACROIX RAR BOUND ES 462273All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-1012752821A,m8hsa-miR-101UACAGUACUGUGAUAACUGAAG
miR-124/50613491355m8hsa-miR-506UAAGGCACCCUUCUGAGUAGA
hsa-miR-124brainUAAGGCACGCGGUGAAUGCC
miR-12813871393m8hsa-miR-128aUCACAGUGAACCGGUCUCUUUU
hsa-miR-128bUCACAGUGAACCGGUCUCUUUC
miR-132/212145214581Ahsa-miR-212SZUAACAGUCUCCAGUCACGGCC
hsa-miR-132brainUAACAGUCUACAGCCAUGGUCG
miR-134289295m8hsa-miR-134brainUGUGACUGGUUGACCAGAGGG
miR-142-3p13731379m8hsa-miR-142-3pUGUAGUGUUUCCUACUUUAUGGA
miR-1442762821Ahsa-miR-144UACAGUAUAGAUGAUGUACUAG
miR-148/1522492551Ahsa-miR-148aUCAGUGCACUACAGAACUUUGU
hsa-miR-152brainUCAGUGCAUGACAGAACUUGGG
hsa-miR-148bUCAGUGCAUCACAGAACUUUGU
miR-1491723m8hsa-miR-149brainUCUGGCUCCGUGUCUUCACUCC
miR-3357985m8hsa-miR-335brainUCAAGAGCAAUAACGAAAAAUGU
miR-491153015371A,m8hsa-miR-491brainAGUGGGGAACCCUUCCAUGAGGA
miR-53912121218m8hsa-miR-539GGAGAAAUUAUCCUUGGUGUGU