Gene Page: PRRT2
Summary ?
GeneID | 112476 |
Symbol | PRRT2 |
Synonyms | BFIC2|BFIS2|DSPB3|DYT10|EKD1|FICCA|ICCA|IFITMD1|PKC |
Description | proline rich transmembrane protein 2 |
Reference | MIM:614386|HGNC:HGNC:30500|Ensembl:ENSG00000167371|HPRD:13995|Vega:OTTHUMG00000177142 |
Gene type | protein-coding |
Map location | 16p11.2 |
Pascal p-value | 0.021 |
Fetal beta | -0.581 |
DMG | 1 (# studies) |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CNV:YES | Copy number variation studies | Manual curation | |
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Nishioka_2013 | Genome-wide DNA methylation analysis | The authors investigated the methylation profiles of DNA in peripheral blood cells from 18 patients with first-episode schizophrenia (FESZ) and from 15 normal controls. | 1 |
GSMA_IIE | Genome scan meta-analysis (European-ancestry samples) | Psr: 0.01775 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg05995267 | 16 | 29822529 | PRRT2 | -0.041 | 0.33 | DMG:Nishioka_2013 |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0009607 | response to biotic stimulus | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0016020 | membrane | IEA | - | |
GO:0016021 | integral to membrane | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
LIU PROSTATE CANCER DN | 481 | 290 | All SZGR 2.0 genes in this pathway |
CORRE MULTIPLE MYELOMA DN | 62 | 41 | All SZGR 2.0 genes in this pathway |
CHARAFE BREAST CANCER LUMINAL VS BASAL UP | 380 | 215 | All SZGR 2.0 genes in this pathway |
CREIGHTON ENDOCRINE THERAPY RESISTANCE 4 | 307 | 185 | All SZGR 2.0 genes in this pathway |
GRADE COLON AND RECTAL CANCER DN | 101 | 65 | All SZGR 2.0 genes in this pathway |
CHICAS RB1 TARGETS SENESCENT | 572 | 352 | All SZGR 2.0 genes in this pathway |
BAKKER FOXO3 TARGETS DN | 187 | 109 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-132/212 | 649 | 655 | m8 | hsa-miR-212SZ | UAACAGUCUCCAGUCACGGCC |
hsa-miR-132brain | UAACAGUCUACAGCCAUGGUCG | ||||
miR-133 | 931 | 937 | 1A | hsa-miR-133a | UUGGUCCCCUUCAACCAGCUGU |
hsa-miR-133b | UUGGUCCCCUUCAACCAGCUA | ||||
hsa-miR-133a | UUGGUCCCCUUCAACCAGCUGU | ||||
hsa-miR-133b | UUGGUCCCCUUCAACCAGCUA | ||||
miR-150 | 37 | 43 | m8 | hsa-miR-150 | UCUCCCAACCCUUGUACCAGUG |
miR-30-5p | 131 | 138 | 1A,m8 | hsa-miR-30a-5p | UGUAAACAUCCUCGACUGGAAG |
hsa-miR-30cbrain | UGUAAACAUCCUACACUCUCAGC | ||||
hsa-miR-30dSZ | UGUAAACAUCCCCGACUGGAAG | ||||
hsa-miR-30bSZ | UGUAAACAUCCUACACUCAGCU | ||||
hsa-miR-30e-5p | UGUAAACAUCCUUGACUGGA | ||||
miR-495 | 1006 | 1012 | m8 | hsa-miR-495brain | AAACAAACAUGGUGCACUUCUUU |
miR-9 | 933 | 939 | m8 | hsa-miR-9SZ | UCUUUGGUUAUCUAGCUGUAUGA |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.