Summary ?
GeneID114801
SymbolTMEM200A
SynonymsKIAA1913|TTMA|TTMC
Descriptiontransmembrane protein 200A
ReferenceHGNC:HGNC:21075|Ensembl:ENSG00000164484|HPRD:13901|Vega:OTTHUMG00000015557
Gene typeprotein-coding
Map location6q23.1
Pascal p-value7.602E-4
Sherlock p-value0.033
Fetal beta-0.712
eGeneMyers' cis & trans

Gene in Data Sources
Gene set name Method of gene setDescriptionInfo
CV:PGCnpGenome-wide Association StudyGWAS

Section I. Genetics and epigenetics annotation

@eQTL annotation

SNP IDChromosomePositioneGeneGene Entrez IDpvalueqvalueTSS distanceeQTL type
rs12302525chr1289726424TMEM200A1148010.14trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0016020membraneIEA-
GO:0016021integral to membraneIEA-

Section V. Pathway annotation

Pathway namePathway size# SZGR 2.0 genes in pathwayInfo
SENGUPTA NASOPHARYNGEAL CARCINOMA UP 294178All SZGR 2.0 genes in this pathway
HORIUCHI WTAP TARGETS UP 306188All SZGR 2.0 genes in this pathway
TAKEDA TARGETS OF NUP98 HOXA9 FUSION 10D UP 194122All SZGR 2.0 genes in this pathway
TAKEDA TARGETS OF NUP98 HOXA9 FUSION 16D UP 175108All SZGR 2.0 genes in this pathway
SENESE HDAC1 AND HDAC2 TARGETS UP 238144All SZGR 2.0 genes in this pathway
SABATES COLORECTAL ADENOMA DN 291176All SZGR 2.0 genes in this pathway
JAATINEN HEMATOPOIETIC STEM CELL UP 316190All SZGR 2.0 genes in this pathway
KOYAMA SEMA3B TARGETS UP 292168All SZGR 2.0 genes in this pathway
GEORGES TARGETS OF MIR192 AND MIR215 893528All SZGR 2.0 genes in this pathway
RODWELL AGING KIDNEY NO BLOOD UP 222139All SZGR 2.0 genes in this pathway
IWANAGA CARCINOGENESIS BY KRAS DN 12081All SZGR 2.0 genes in this pathway
GENTLES LEUKEMIC STEM CELL UP 2915All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-338105010561Ahsa-miR-338brainUCCAGCAUCAGUGAUUUUGUUGA
miR-9107310791Ahsa-miR-9SZUCUUUGGUUAUCUAGCUGUAUGA