Summary ?
GeneID114815
SymbolSORCS1
SynonymshSorCS
Descriptionsortilin related VPS10 domain containing receptor 1
ReferenceMIM:606283|HGNC:HGNC:16697|Ensembl:ENSG00000108018|HPRD:12098|Vega:OTTHUMG00000019018
Gene typeprotein-coding
Map location10q23-q25
Pascal p-value0.029
Sherlock p-value0.915
Fetal beta-0.51

Gene in Data Sources
Gene set name Method of gene setDescriptionInfo
CV:GWASdbGenome-wide Association StudiesGWASdb records for schizophrenia
CV:PGCnpGenome-wide Association StudyGWAS
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 2 

Section I. Genetics and epigenetics annotation


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0008188neuropeptide receptor activityNASNeurotransmitter (GO term level: 8)11499680 
GO:0005515protein bindingIDA12482870 
GO:0005515protein bindingIPI12482870 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0007218neuropeptide signaling pathwayNASNeurotransmitter (GO term level: 8)11499680 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0016020membraneIDA12482870 
GO:0016021integral to membraneIEA-

Section V. Pathway annotation

Pathway namePathway size# SZGR 2.0 genes in pathwayInfo
SABATES COLORECTAL ADENOMA DN 291176All SZGR 2.0 genes in this pathway
GAUSSMANN MLL AF4 FUSION TARGETS G UP 238135All SZGR 2.0 genes in this pathway
BENPORATH SUZ12 TARGETS 1038678All SZGR 2.0 genes in this pathway
BENPORATH EED TARGETS 1062725All SZGR 2.0 genes in this pathway
BENPORATH ES WITH H3K27ME3 1118744All SZGR 2.0 genes in this pathway
BENPORATH PRC2 TARGETS 652441All SZGR 2.0 genes in this pathway
BRUINS UVC RESPONSE LATE 1137655All SZGR 2.0 genes in this pathway
LIM MAMMARY STEM CELL UP 489314All SZGR 2.0 genes in this pathway
ZWANG TRANSIENTLY UP BY 1ST EGF PULSE ONLY 1839928All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-122220226m8hsa-miR-122aUGGAGUGUGACAAUGGUGUUUGU
miR-124/50622152221m8hsa-miR-506UAAGGCACCCUUCUGAGUAGA
hsa-miR-124brainUAAGGCACGCGGUGAAUGCC
miR-19310161Ahsa-miR-193aAACUGGCCUACAAAGUCCCAG
hsa-miR-193bAACUGGCCCUCAAAGUCCCGCUUU
miR-21957631Ahsa-miR-219brainUGAUUGUCCAAACGCAAUUCU
hsa-miR-219brainUGAUUGUCCAAACGCAAUUCU
miR-3201391451Ahsa-miR-320AAAAGCUGGGUUGAGAGGGCGAA
miR-324-3p188194m8hsa-miR-324-3pCCACUGCCCCAGGUGCUGCUGG
miR-33030213027m8hsa-miR-330brainGCAAAGCACACGGCCUGCAGAGA
miR-33532633269m8hsa-miR-335brainUCAAGAGCAAUAACGAAAAAUGU
miR-339213421401Ahsa-miR-339UCCCUGUCCUCCAGGAGCUCA
miR-363280128071Ahsa-miR-363AUUGCACGGUAUCCAUCUGUAA
miR-376c324132471Ahsa-miR-376cAACAUAGAGGAAAUUCCACG
miR-383258264m8hsa-miR-383brainAGAUCAGAAGGUGAUUGUGGCU
miR-384203620421Ahsa-miR-384AUUCCUAGAAAUUGUUCAUA
miR-452280228091A,m8hsa-miR-452UGUUUGCAGAGGAAACUGAGAC
miR-486194200m8hsa-miR-486UCCUGUACUGAGCUGCCCCGAG
miR-490139414001Ahsa-miR-490CAACCUGGAGGACUCCAUGCUG
miR-500279928061A,m8hsa-miR-500AUGCACCUGGGCAAGGAUUCUG