SZGR2

Summary ?

GeneID	114836
Symbol	SLAMF6
Synonyms	CD352\|KALI\|KALIb\|Ly108\|NTB-A\|NTBA\|SF2000
Description	SLAM family member 6
Reference	MIM:606446\|HGNC:HGNC:21392\|Ensembl:ENSG00000162739\|HPRD:05920\|Vega:OTTHUMG00000022729
Gene type	protein-coding
Map location	1q23.2
Fetal beta	-0.098
DMG	1 (# studies)

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:vanEijk_2014	Genome-wide DNA methylation analysis	This dataset includes 432 differentially methylated CpG sites corresponding to 391 unique transcripts between schizophrenia patients (n=260) and unaffected controls (n=250).	2
GSMA_I	Genome scan meta-analysis	Psr: 0.0235
GSMA_IIA	Genome scan meta-analysis (All samples)	Psr: 0.00814

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg18920397	1	160765805	SLAMF6	2.61E-6	-3.81		DMG:vanEijk_2014
cg11721194	1	160709239	SLAMF6	1.59E-5	-7.243		DMG:vanEijk_2014

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0004872	receptor activity	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0016020	membrane	IEA		-
GO:0016021	integral to membrane	IEA		-

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
ZHOU INFLAMMATORY RESPONSE LIVE DN	384	220	All SZGR 2.0 genes in this pathway
ODONNELL TFRC TARGETS UP	456	228	All SZGR 2.0 genes in this pathway
ZHOU INFLAMMATORY RESPONSE FIMA DN	284	156	All SZGR 2.0 genes in this pathway
ZHENG BOUND BY FOXP3	491	310	All SZGR 2.0 genes in this pathway
ZHENG FOXP3 TARGETS IN THYMUS UP	196	137	All SZGR 2.0 genes in this pathway
KONDO EZH2 TARGETS	245	148	All SZGR 2.0 genes in this pathway
CHEN METABOLIC SYNDROM NETWORK	1210	725	All SZGR 2.0 genes in this pathway
CHEN LIVER METABOLISM QTL CIS	93	40	All SZGR 2.0 genes in this pathway
ONO AML1 TARGETS DN	41	25	All SZGR 2.0 genes in this pathway
ONO FOXP3 TARGETS DN	42	23	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
let-7/98	850	857	1A,m8	hsa-let-7a^brain	UGAGGUAGUAGGUUGUAUAGUU
				hsa-let-7b^brain	UGAGGUAGUAGGUUGUGUGGUU
				hsa-let-7c^brain	UGAGGUAGUAGGUUGUAUGGUU
				hsa-let-7d^brain	AGAGGUAGUAGGUUGCAUAGU
				hsa-let-7e^brain	UGAGGUAGGAGGUUGUAUAGU
				hsa-let-7f^brain	UGAGGUAGUAGAUUGUAUAGUU
				hsa-miR-98^brain	UGAGGUAGUAAGUUGUAUUGUU
				hsa-let-7g^SZ	UGAGGUAGUAGUUUGUACAGU
				hsa-let-7i^brain	UGAGGUAGUAGUUUGUGCUGU
miR-370	357	364	1A,m8	hsa-miR-370^brain	GCCUGCUGGGGUGGAACCUGG

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: SLAMF6