Gene Page: UHMK1
Summary ?
| GeneID | 127933 |
| Symbol | UHMK1 |
| Synonyms | KIS|KIST|P-CIP2 |
| Description | U2AF homology motif (UHM) kinase 1 |
| Reference | MIM:608849|HGNC:HGNC:19683|Ensembl:ENSG00000152332|HPRD:12318|Vega:OTTHUMG00000031373 |
| Gene type | protein-coding |
| Map location | 1q23.3 |
| Fetal beta | 0.453 |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
| Association | A combined odds ratio method (Sun et al. 2008), association studies | 1 | Link to SZGene |
| GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.00814 | |
| Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenias | Click to show details |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0000166 | nucleotide binding | IEA | - | |
| GO:0003723 | RNA binding | IEA | - | |
| GO:0005515 | protein binding | IPI | 12093740 | |
| GO:0005524 | ATP binding | IC | 12093740 | |
| GO:0004674 | protein serine/threonine kinase activity | ISS | - | |
| GO:0016740 | transferase activity | IC | 12093740 | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0007050 | cell cycle arrest | IMP | 12093740 | |
| GO:0018105 | peptidyl-serine phosphorylation | ISS | - | |
| GO:0046777 | protein amino acid autophosphorylation | IDA | 12093740 | |
| GO:0046825 | regulation of protein export from nucleus | IDA | 12093740 | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005634 | nucleus | ISS | - | |
| GO:0005737 | cytoplasm | ISS | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| GARY CD5 TARGETS UP | 473 | 314 | All SZGR 2.0 genes in this pathway |
| HORIUCHI WTAP TARGETS DN | 310 | 188 | All SZGR 2.0 genes in this pathway |
| OSMAN BLADDER CANCER UP | 404 | 246 | All SZGR 2.0 genes in this pathway |
| GINESTIER BREAST CANCER 20Q13 AMPLIFICATION UP | 119 | 66 | All SZGR 2.0 genes in this pathway |
| TAKEDA TARGETS OF NUP98 HOXA9 FUSION 8D DN | 205 | 127 | All SZGR 2.0 genes in this pathway |
| SENESE HDAC1 TARGETS UP | 457 | 269 | All SZGR 2.0 genes in this pathway |
| SENESE HDAC3 TARGETS UP | 501 | 327 | All SZGR 2.0 genes in this pathway |
| RODRIGUES THYROID CARCINOMA ANAPLASTIC UP | 722 | 443 | All SZGR 2.0 genes in this pathway |
| GRAESSMANN APOPTOSIS BY DOXORUBICIN UP | 1142 | 669 | All SZGR 2.0 genes in this pathway |
| BYSTRYKH HEMATOPOIESIS STEM CELL QTL TRANS | 882 | 572 | All SZGR 2.0 genes in this pathway |
| MCCLUNG DELTA FOSB TARGETS 8WK | 47 | 38 | All SZGR 2.0 genes in this pathway |
| MCCLUNG CREB1 TARGETS DN | 57 | 39 | All SZGR 2.0 genes in this pathway |
| RIGGI EWING SARCOMA PROGENITOR UP | 430 | 288 | All SZGR 2.0 genes in this pathway |
| JOHNSTONE PARVB TARGETS 3 DN | 918 | 550 | All SZGR 2.0 genes in this pathway |
| BRUINS UVC RESPONSE LATE | 1137 | 655 | All SZGR 2.0 genes in this pathway |
| LINSLEY MIR16 TARGETS | 206 | 127 | All SZGR 2.0 genes in this pathway |
| FORTSCHEGGER PHF8 TARGETS DN | 784 | 464 | All SZGR 2.0 genes in this pathway |
| PEDRIOLI MIR31 TARGETS DN | 418 | 245 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-148/152 | 169 | 175 | 1A | hsa-miR-148a | UCAGUGCACUACAGAACUUUGU |
| hsa-miR-152brain | UCAGUGCAUGACAGAACUUGGG | ||||
| hsa-miR-148b | UCAGUGCAUCACAGAACUUUGU | ||||
| miR-19 | 626 | 632 | 1A | hsa-miR-19a | UGUGCAAAUCUAUGCAAAACUGA |
| hsa-miR-19b | UGUGCAAAUCCAUGCAAAACUGA | ||||
| miR-199 | 438 | 444 | 1A | hsa-miR-199a | CCCAGUGUUCAGACUACCUGUUC |
| hsa-miR-199b | CCCAGUGUUUAGACUAUCUGUUC | ||||
| miR-324-3p | 563 | 569 | 1A | hsa-miR-324-3p | CCACUGCCCCAGGUGCUGCUGG |
| miR-375 | 855 | 861 | 1A | hsa-miR-375 | UUUGUUCGUUCGGCUCGCGUGA |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.