Gene Page: COL4A4
Summary ?
| GeneID | 1286 |
| Symbol | COL4A4 |
| Synonyms | CA44 |
| Description | collagen type IV alpha 4 |
| Reference | MIM:120131|HGNC:HGNC:2206|Ensembl:ENSG00000081052|HPRD:00360|Vega:OTTHUMG00000149892 |
| Gene type | protein-coding |
| Map location | 2q35-q37 |
| Pascal p-value | 0.04 |
| Fetal beta | -1.035 |
| eGene | Myers' cis & trans |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
| GSMA_IIE | Genome scan meta-analysis (European-ancestry samples) | Psr: 0.01016 | |
| GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.00916 | |
| Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
| GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 |
Section I. Genetics and epigenetics annotation
eQTL annotation
| SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
|---|---|---|---|---|---|---|---|---|
| rs11694195 | chr2 | 228920752 | COL4A4 | 1286 | 0.15 | cis | ||
| rs3924767 | chr2 | 228922592 | COL4A4 | 1286 | 0.12 | cis |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| AOC3 | 0.71 | 0.80 |
| C7orf58 | 0.71 | 0.68 |
| TBX18 | 0.68 | 0.75 |
| FAM129A | 0.67 | 0.77 |
| GJA5 | 0.66 | 0.71 |
| LAMA2 | 0.64 | 0.71 |
| CYP1B1 | 0.61 | 0.76 |
| MYOF | 0.61 | 0.70 |
| COL14A1 | 0.59 | 0.76 |
| ITGA1 | 0.59 | 0.57 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| SNHG12 | -0.29 | -0.50 |
| RPL17P20 | -0.27 | -0.46 |
| RPS21 | -0.27 | -0.53 |
| RPL31 | -0.26 | -0.51 |
| RPS27A | -0.26 | -0.55 |
| RPL26 | -0.26 | -0.51 |
| CHMP4A | -0.26 | -0.34 |
| RPL37 | -0.26 | -0.52 |
| RPL34 | -0.25 | -0.52 |
| RPL23A | -0.25 | -0.50 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0005488 | binding | IEA | - | |
| GO:0005201 | extracellular matrix structural constituent | ISS | - | |
| GO:0005201 | extracellular matrix structural constituent | TAS | 8253711 | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0042062 | long-term strengthening of neuromuscular junction | IDA | Synap (GO term level: 13) | 2211832 |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005576 | extracellular region | IEA | - | |
| GO:0005581 | collagen | IEA | - | |
| GO:0005587 | collagen type IV | IDA | 7523402 |
Section IV. Protein-protein interaction annotation
| Interactors | Aliases B | Official full name B | Experimental | Source | PubMed ID |
|---|---|---|---|---|---|
| ANTXR2 | CMG-2 | CMG2 | FLJ31074 | ISH | JHF | MGC111533 | MGC45856 | anthrax toxin receptor 2 | - | HPRD | 11683410 |
| CD93 | C1QR1 | C1qR(P) | C1qRP | CDw93 | MXRA4 | dJ737E23.1 | CD93 molecule | - | HPRD | 9136074 |
| DCN | CSCD | DSPG2 | PG40 | PGII | PGS2 | SLRR1B | decorin | - | HPRD | 10382266 |
| FBLN2 | - | fibulin 2 | - | HPRD,BioGRID | 7500359 |
| FN1 | CIG | DKFZp686F10164 | DKFZp686H0342 | DKFZp686I1370 | DKFZp686O13149 | ED-B | FINC | FN | FNZ | GFND | GFND2 | LETS | MSF | fibronectin 1 | - | HPRD | 3997552 |
| HABP2 | FSAP | HABP | HGFAL | PHBP | hyaluronan binding protein 2 | - | HPRD,BioGRID | 1724753 |
| MATN2 | - | matrilin 2 | - | HPRD | 12180907 |
| MMP9 | CLG4B | GELB | MMP-9 | matrix metallopeptidase 9 (gelatinase B, 92kDa gelatinase, 92kDa type IV collagenase) | - | HPRD,BioGRID | 9878537 |
| OSM | MGC20461 | oncostatin M | - | HPRD,BioGRID | 11711546 |
| SAA1 | MGC111216 | PIG4 | SAA | TP53I4 | serum amyloid A1 | - | HPRD | 8995276 |
| SERPINE2 | GDN | PI7 | PN1 | PNI | serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 2 | - | HPRD,BioGRID | 8006028 |
| TGFBI | BIGH3 | CDB1 | CDG2 | CDGG1 | CSD | CSD1 | CSD2 | CSD3 | EBMD | LCD1 | transforming growth factor, beta-induced, 68kDa | - | HPRD | 11867580 |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| KEGG FOCAL ADHESION | 201 | 138 | All SZGR 2.0 genes in this pathway |
| KEGG ECM RECEPTOR INTERACTION | 84 | 53 | All SZGR 2.0 genes in this pathway |
| KEGG PATHWAYS IN CANCER | 328 | 259 | All SZGR 2.0 genes in this pathway |
| KEGG SMALL CELL LUNG CANCER | 84 | 67 | All SZGR 2.0 genes in this pathway |
| BIOCARTA AMI PATHWAY | 20 | 13 | All SZGR 2.0 genes in this pathway |
| BIOCARTA ACE2 PATHWAY | 13 | 7 | All SZGR 2.0 genes in this pathway |
| BIOCARTA INTRINSIC PATHWAY | 23 | 15 | All SZGR 2.0 genes in this pathway |
| BIOCARTA PLATELETAPP PATHWAY | 14 | 10 | All SZGR 2.0 genes in this pathway |
| BIOCARTA VITCB PATHWAY | 11 | 6 | All SZGR 2.0 genes in this pathway |
| PID INTEGRIN1 PATHWAY | 66 | 44 | All SZGR 2.0 genes in this pathway |
| PID INTEGRIN3 PATHWAY | 43 | 25 | All SZGR 2.0 genes in this pathway |
| PID AVB3 INTEGRIN PATHWAY | 75 | 53 | All SZGR 2.0 genes in this pathway |
| PID SYNDECAN 1 PATHWAY | 46 | 29 | All SZGR 2.0 genes in this pathway |
| REACTOME DEVELOPMENTAL BIOLOGY | 396 | 292 | All SZGR 2.0 genes in this pathway |
| REACTOME EXTRACELLULAR MATRIX ORGANIZATION | 87 | 42 | All SZGR 2.0 genes in this pathway |
| REACTOME COLLAGEN FORMATION | 58 | 31 | All SZGR 2.0 genes in this pathway |
| REACTOME INTEGRIN CELL SURFACE INTERACTIONS | 79 | 48 | All SZGR 2.0 genes in this pathway |
| REACTOME SIGNALING BY PDGF | 122 | 93 | All SZGR 2.0 genes in this pathway |
| REACTOME AXON GUIDANCE | 251 | 188 | All SZGR 2.0 genes in this pathway |
| REACTOME NCAM1 INTERACTIONS | 39 | 27 | All SZGR 2.0 genes in this pathway |
| REACTOME NCAM SIGNALING FOR NEURITE OUT GROWTH | 64 | 49 | All SZGR 2.0 genes in this pathway |
| SENESE HDAC1 AND HDAC2 TARGETS DN | 232 | 139 | All SZGR 2.0 genes in this pathway |
| GRAESSMANN APOPTOSIS BY DOXORUBICIN UP | 1142 | 669 | All SZGR 2.0 genes in this pathway |
| PEREZ TP53 TARGETS | 1174 | 695 | All SZGR 2.0 genes in this pathway |
| SHETH LIVER CANCER VS TXNIP LOSS PAM2 | 153 | 102 | All SZGR 2.0 genes in this pathway |
| BYSTRYKH HEMATOPOIESIS STEM CELL QTL TRANS | 882 | 572 | All SZGR 2.0 genes in this pathway |
| FLECHNER BIOPSY KIDNEY TRANSPLANT REJECTED VS OK DN | 546 | 351 | All SZGR 2.0 genes in this pathway |
| CUI TCF21 TARGETS 2 DN | 830 | 547 | All SZGR 2.0 genes in this pathway |
| BAELDE DIABETIC NEPHROPATHY DN | 434 | 302 | All SZGR 2.0 genes in this pathway |
| ZHANG GATA6 TARGETS DN | 64 | 46 | All SZGR 2.0 genes in this pathway |
| RIZKI TUMOR INVASIVENESS 3D DN | 270 | 181 | All SZGR 2.0 genes in this pathway |
| RIGGI EWING SARCOMA PROGENITOR UP | 430 | 288 | All SZGR 2.0 genes in this pathway |
| WEST ADRENOCORTICAL TUMOR DN | 546 | 362 | All SZGR 2.0 genes in this pathway |
| BRUECKNER TARGETS OF MIRLET7A3 UP | 111 | 69 | All SZGR 2.0 genes in this pathway |
| YAUCH HEDGEHOG SIGNALING PARACRINE DN | 264 | 159 | All SZGR 2.0 genes in this pathway |
| MIKKELSEN MCV6 ICP WITH H3K4ME3 AND H3K27ME3 | 34 | 21 | All SZGR 2.0 genes in this pathway |
| MIKKELSEN MEF ICP WITH H3K27ME3 | 206 | 108 | All SZGR 2.0 genes in this pathway |
| MIKKELSEN IPS ICP WITH H3K4ME3 AND H327ME3 | 126 | 83 | All SZGR 2.0 genes in this pathway |
| MIKKELSEN ES ICP WITH H3K4ME3 AND H3K27ME3 | 137 | 85 | All SZGR 2.0 genes in this pathway |
| LEE BMP2 TARGETS UP | 745 | 475 | All SZGR 2.0 genes in this pathway |
| ACEVEDO FGFR1 TARGETS IN PROSTATE CANCER MODEL DN | 308 | 187 | All SZGR 2.0 genes in this pathway |
| NABA COLLAGENS | 44 | 26 | All SZGR 2.0 genes in this pathway |
| NABA CORE MATRISOME | 275 | 148 | All SZGR 2.0 genes in this pathway |
| NABA BASEMENT MEMBRANES | 40 | 22 | All SZGR 2.0 genes in this pathway |
| NABA MATRISOME | 1028 | 559 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-150 | 1092 | 1099 | 1A,m8 | hsa-miR-150 | UCUCCCAACCCUUGUACCAGUG |
| miR-23 | 4433 | 4440 | 1A,m8 | hsa-miR-23abrain | AUCACAUUGCCAGGGAUUUCC |
| hsa-miR-23bbrain | AUCACAUUGCCAGGGAUUACC | ||||
| miR-29 | 82 | 88 | m8 | hsa-miR-29aSZ | UAGCACCAUCUGAAAUCGGUU |
| hsa-miR-29bSZ | UAGCACCAUUUGAAAUCAGUGUU | ||||
| hsa-miR-29cSZ | UAGCACCAUUUGAAAUCGGU | ||||
| hsa-miR-29aSZ | UAGCACCAUCUGAAAUCGGUU | ||||
| hsa-miR-29bSZ | UAGCACCAUUUGAAAUCAGUGUU | ||||
| hsa-miR-29cSZ | UAGCACCAUUUGAAAUCGGU | ||||
| miR-299-5p | 4352 | 4358 | 1A | hsa-miR-299-5p | UGGUUUACCGUCCCACAUACAU |
| miR-323 | 4433 | 4439 | 1A | hsa-miR-323brain | GCACAUUACACGGUCGACCUCU |
| miR-410 | 4579 | 4585 | 1A | hsa-miR-410 | AAUAUAACACAGAUGGCCUGU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.