Gene Page: AP1S3

Summary
GeneID  130340
Symbol  AP1S3
Synonyms  -
Description  adaptor-related protein complex 1, sigma 3 subunit
See related  HGNC:18971|Ensembl:ENSG00000152056|HPRD:16495|
Locus tag  -
Gene type  protein-coding
Map location  2q36.1
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GSMA_IIEgenome scan meta-analysis (European-ancestry samples)Psr: 0.01016 
GSMA_IIAgenome scan meta-analysis (All samples)Psr: 0.00916 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005515protein bindingIEA-
GO:0008565protein transporter activityIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006897endocytosisIEA-
GO:0006886intracellular protein transportIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005794Golgi apparatusIEA-
GO:0005829cytosolEXP15569716 
GO:0030117membrane coatIEA-
GO:0016020membraneIEA-
GO:0005905coated pitIEA-
GO:0030130clathrin coat of trans-Golgi network vesicleIEA-
GO:0031410cytoplasmic vesicleIEA-
GO:0030659cytoplasmic vesicle membraneIEA-
GO:0030131clathrin adaptor complexIEA-
 
Pathway annotation
Pathway namePathway size# SZGR genes in pathwayInfo
KEGG_LYSOSOME 12183All SZGR genes in this pathway
CHEMNITZ_RESPONSE_TO_PROSTAGLANDIN_E2_DN 391222All SZGR genes in this pathway
TAKEDA_TARGETS_OF_NUP98_HOXA9_FUSION_16D_UP 175108All SZGR genes in this pathway
SENESE_HDAC1_TARGETS_UP 457269All SZGR genes in this pathway
SENESE_HDAC3_TARGETS_UP 501327All SZGR genes in this pathway
SABATES_COLORECTAL_ADENOMA_UP 14175All SZGR genes in this pathway
GAUSSMANN_MLL_AF4_FUSION_TARGETS_A_UP 191128All SZGR genes in this pathway
COWLING_MYCN_TARGETS 4327All SZGR genes in this pathway
SCHAEFFER_PROSTATE_DEVELOPMENT_48HR_UP 487286All SZGR genes in this pathway
ZHANG_BREAST_CANCER_PROGENITORS_UP 425253All SZGR genes in this pathway
BOYLAN_MULTIPLE_MYELOMA_C_D_UP 13995All SZGR genes in this pathway
MEISSNER_NPC_HCP_WITH_H3_UNMETHYLATED 536296All SZGR genes in this pathway
MEISSNER_BRAIN_HCP_WITH_H3K4ME3_AND_H3K27ME3 1069729All SZGR genes in this pathway
VANLOO_SP3_TARGETS_DN 8947All SZGR genes in this pathway
TERAO_AOX4_TARGETS_HG_UP 2820All SZGR genes in this pathway
MADAN_DPPA4_TARGETS 4626All SZGR genes in this pathway
PEDERSEN_METASTASIS_BY_ERBB2_ISOFORM_7 403240All SZGR genes in this pathway
PEDERSEN_TARGETS_OF_611CTF_ISOFORM_OF_ERBB2 7645All SZGR genes in this pathway
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-186328332891Ahsa-miR-186CAAAGAAUUCUCCUUUUGGGCUU
miR-188112118m8hsa-miR-188CAUCCCUUGCAUGGUGGAGGGU
miR-204/211111117m8hsa-miR-204brainUUCCCUUUGUCAUCCUAUGCCU
hsa-miR-211UUCCCUUUGUCAUCCUUCGCCU
miR-4963763821Ahsa-miR-496AUUACAUGGCCAAUCUC
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.