Summary ?
GeneID1388
SymbolATF6B
SynonymsCREB-RP|CREBL1|G13
Descriptionactivating transcription factor 6 beta
ReferenceMIM:600984|HGNC:HGNC:2349|Ensembl:ENSG00000213676|HPRD:02992|Vega:OTTHUMG00000031296
Gene typeprotein-coding
Map location6p21.3
Pascal p-value1E-12
Sherlock p-value0.007
Fetal beta-0.427

Gene in Data Sources
Gene set name Method of gene setDescriptionInfo
CV:PGCnpGenome-wide Association StudyGWAS
AssociationA combined odds ratio method (Sun et al. 2008), association studies1Link to SZGene

Section I. Genetics and epigenetics annotation


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
GenePearson's Correlation Spearman's Correlation
LRRC240.910.91
COMTD10.890.89
GNB20.890.91
C19orf220.890.92
FBL0.880.92
NFKBIE0.880.88
LRFN40.880.92
HTRA20.870.87
RTN20.870.88
AC009133.10.870.90
Top 10 negatively co-expressed genes
GenePearson's Correlation Spearman's Correlation
AF347015.27-0.68-0.75
AF347015.33-0.67-0.75
AF347015.8-0.66-0.75
MT-CO2-0.66-0.72
MT-CYB-0.66-0.74
AF347015.31-0.65-0.72
AF347015.15-0.65-0.74
AF347015.26-0.64-0.75
AF347015.2-0.64-0.73
MT-ATP8-0.59-0.76

Section III. Gene Ontology annotation

Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0003700transcription factor activityTAS8586413 
GO:0043565sequence-specific DNA bindingIEA-
GO:0046983protein dimerization activityIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006355regulation of transcription, DNA-dependentIEA-
GO:0006350transcriptionTAS8586413 
GO:0006986response to unfolded proteinIEA-
GO:0007165signal transductionTAS8586413 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005789endoplasmic reticulum membraneIEA-
GO:0005622intracellularIDA8870652 
GO:0005634nucleusTAS8586413 
GO:0005783endoplasmic reticulumIEA-
GO:0016020membraneIEA-
GO:0016021integral to membraneIEA-

Section V. Pathway annotation

Pathway namePathway size# SZGR 2.0 genes in pathwayInfo
LIU PROSTATE CANCER UP 9657All SZGR 2.0 genes in this pathway
LIU SOX4 TARGETS UP 13794All SZGR 2.0 genes in this pathway
BOGNI TREATMENT RELATED MYELOID LEUKEMIA UP 3019All SZGR 2.0 genes in this pathway
ENK UV RESPONSE EPIDERMIS DN 508354All SZGR 2.0 genes in this pathway
TARTE PLASMA CELL VS PLASMABLAST UP 398262All SZGR 2.0 genes in this pathway
YAGI AML SURVIVAL 12987All SZGR 2.0 genes in this pathway
KAYO CALORIE RESTRICTION MUSCLE DN 8759All SZGR 2.0 genes in this pathway
IVANOVA HEMATOPOIESIS STEM CELL AND PROGENITOR 681420All SZGR 2.0 genes in this pathway
SU PLACENTA 3018All SZGR 2.0 genes in this pathway
GRADE COLON CANCER UP 871505All SZGR 2.0 genes in this pathway
MILI PSEUDOPODIA HAPTOTAXIS DN 668419All SZGR 2.0 genes in this pathway
SAKAI CHRONIC HEPATITIS VS LIVER CANCER UP 8363All SZGR 2.0 genes in this pathway
YAO TEMPORAL RESPONSE TO PROGESTERONE CLUSTER 14 14386All SZGR 2.0 genes in this pathway
ZWANG TRANSIENTLY UP BY 1ST EGF PULSE ONLY 1839928All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-93.hd/291-3p/294/295/302/372/373/5201281351A,m8hsa-miR-93brainAAAGUGCUGUUCGUGCAGGUAG
hsa-miR-302aUAAGUGCUUCCAUGUUUUGGUGA
hsa-miR-302bUAAGUGCUUCCAUGUUUUAGUAG
hsa-miR-302cUAAGUGCUUCCAUGUUUCAGUGG
hsa-miR-302dUAAGUGCUUCCAUGUUUGAGUGU
hsa-miR-372AAAGUGCUGCGACAUUUGAGCGU
hsa-miR-373GAAGUGCUUCGAUUUUGGGGUGU
hsa-miR-520eAAAGUGCUUCCUUUUUGAGGG
hsa-miR-520aAAAGUGCUUCCCUUUGGACUGU
hsa-miR-520bAAAGUGCUUCCUUUUAGAGGG
hsa-miR-520cAAAGUGCUUCCUUUUAGAGGGUU
hsa-miR-520dAAAGUGCUUCUCUUUGGUGGGUU