SZGR2

Summary ?

GeneID	140767
Symbol	NRSN1
Synonyms	VMP\|p24
Description	neurensin 1
Reference	MIM:616630\|HGNC:HGNC:17881\|Ensembl:ENSG00000152954\|HPRD:18285\|Vega:OTTHUMG00000016406
Gene type	protein-coding
Map location	6p22.3
Pascal p-value	0.741
Sherlock p-value	0.888

Gene in Data Sources

Gene set name	Method of gene set	Description
CV:GWASdb	Genome-wide Association Studies	GWASdb records for schizophrenia
CV:PGCnp	Genome-wide Association Study	GWAS
GSMA_I	Genome scan meta-analysis	Psr: 0.033
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 8

Section I. Genetics and epigenetics annotation

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section III. Gene Ontology annotation

Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0007399	nervous system development	IEA	neurite (GO term level: 5)	-
GO:0007399	nervous system development	ISS	neurite (GO term level: 5)	-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0043025	cell soma	IEA	axon, dendrite (GO term level: 4)	-
GO:0043025	cell soma	ISS	axon, dendrite (GO term level: 4)	-
GO:0043005	neuron projection	IEA	neuron, axon, neurite, dendrite (GO term level: 5)	-
GO:0043005	neuron projection	ISS	neuron, axon, neurite, dendrite (GO term level: 5)	-
GO:0030426	growth cone	IEA	axon, dendrite (GO term level: 5)	-
GO:0030426	growth cone	ISS	axon, dendrite (GO term level: 5)	-
GO:0016020	membrane	IEA		-
GO:0016021	integral to membrane	ISS		-
GO:0016023	cytoplasmic membrane-bounded vesicle	IEA		-
GO:0030133	transport vesicle	TAS		12463420

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
DARWICHE SKIN TUMOR PROMOTER UP	142	96	All SZGR 2.0 genes in this pathway
DARWICHE PAPILLOMA RISK LOW DN	165	107	All SZGR 2.0 genes in this pathway
DARWICHE PAPILLOMA RISK HIGH UP	147	101	All SZGR 2.0 genes in this pathway
DARWICHE SQUAMOUS CELL CARCINOMA UP	146	104	All SZGR 2.0 genes in this pathway
DAWSON METHYLATED IN LYMPHOMA TCL1	59	45	All SZGR 2.0 genes in this pathway
LIANG HEMATOPOIESIS STEM CELL NUMBER SMALL VS HUGE DN	33	22	All SZGR 2.0 genes in this pathway
LEE TARGETS OF PTCH1 AND SUFU DN	83	69	All SZGR 2.0 genes in this pathway
MOLENAAR TARGETS OF CCND1 AND CDK4 UP	67	48	All SZGR 2.0 genes in this pathway
LIN NPAS4 TARGETS UP	163	100	All SZGR 2.0 genes in this pathway
YAUCH HEDGEHOG SIGNALING PARACRINE DN	264	159	All SZGR 2.0 genes in this pathway
MIKKELSEN IPS HCP WITH H3 UNMETHYLATED	80	50	All SZGR 2.0 genes in this pathway
MIKKELSEN MEF HCP WITH H3 UNMETHYLATED	228	119	All SZGR 2.0 genes in this pathway
PURBEY TARGETS OF CTBP1 NOT SATB1 UP	344	215	All SZGR 2.0 genes in this pathway
SERVITJA ISLET HNF1A TARGETS UP	163	111	All SZGR 2.0 genes in this pathway
RAO BOUND BY SALL4 ISOFORM B	517	302	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-29	393	399	m8	hsa-miR-29a^SZ	UAGCACCAUCUGAAAUCGGUU
				hsa-miR-29b^SZ	UAGCACCAUUUGAAAUCAGUGUU
				hsa-miR-29c^SZ	UAGCACCAUUUGAAAUCGGU

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: NRSN1