SZGR2

Summary ?

GeneID	143425
Symbol	SYT9
Synonyms	-
Description	synaptotagmin 9
Reference	MIM:613528\|HGNC:HGNC:19265\|Ensembl:ENSG00000170743\|HPRD:11618\|Vega:OTTHUMG00000165499
Gene type	protein-coding
Map location	11p15.4
Pascal p-value	0.168
TADA p-value	0.001
Fetal beta	-0.946
eGene	Meta
Support	EXOCYTOSIS

Gene in Data Sources

Gene set name	Method of gene set	Description
CV:PGCnp	Genome-wide Association Study	GWAS
DNM:McCarthy_2014	Whole Exome Sequencing analysis	Whole exome sequencing of 57 trios with sporadic or familial schizophrenia.
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 1

Section I. Genetics and epigenetics annotation

DNM table

Gene	Chromosome	Position	Ref	Alt	Transcript	AA change	Mutation type	Sift	CG46	Trait	Study
SYT9	chr11	7334755			NM_175733	p.D209fs	frameshift INS	NA	NA	Schizophrenia	DNM:McCarthy_2014
SYT9	chr11	7439282	C	T	NM_175733	.	silent			Schizophrenia	DNM:Gulsuner_2013

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005509	calcium ion binding	IEA		-
GO:0005515	protein binding	IEA		-
GO:0005215	transporter activity	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0006810	transport	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0008021	synaptic vesicle	IEA	Synap, Neurotransmitter (GO term level: 12)	-
GO:0045202	synapse	IEA	neuron, Synap, Neurotransmitter, Glial (GO term level: 2)	-
GO:0016020	membrane	IEA		-
GO:0016021	integral to membrane	IEA		-
GO:0030054	cell junction	IEA		-
GO:0031410	cytoplasmic vesicle	IEA		-

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
ZHOU INFLAMMATORY RESPONSE LIVE UP	485	293	All SZGR 2.0 genes in this pathway
ZHOU INFLAMMATORY RESPONSE FIMA UP	544	308	All SZGR 2.0 genes in this pathway
ZHOU INFLAMMATORY RESPONSE LPS UP	431	237	All SZGR 2.0 genes in this pathway
CHEBOTAEV GR TARGETS DN	120	73	All SZGR 2.0 genes in this pathway
YAMAZAKI TCEB3 TARGETS DN	215	132	All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS UP	1305	895	All SZGR 2.0 genes in this pathway
SENGUPTA EBNA1 ANTICORRELATED	173	85	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-196	465	471	m8	hsa-miR-196a	UAGGUAGUUUCAUGUUGUUGG
miR-196	465	471	m8	hsa-miR-196b	UAGGUAGUUUCCUGUUGUUGG
miR-29	429	435	1A	hsa-miR-29a^SZ	UAGCACCAUCUGAAAUCGGUU
				hsa-miR-29b^SZ	UAGCACCAUUUGAAAUCAGUGUU
				hsa-miR-29c^SZ	UAGCACCAUUUGAAAUCGGU
miR-544	1782	1788	1A	hsa-miR-544	AUUCUGCAUUUUUAGCAAGU
miR-9	1213	1219	m8	hsa-miR-9^SZ	UCUUUGGUUAUCUAGCUGUAUGA

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: SYT9