SZGR2

Summary ?

GeneID	1459
Symbol	CSNK2A2
Synonyms	CK2A2\|CK2alpha'\|CSNK2A1
Description	casein kinase 2 alpha 2
Reference	MIM:115442\|HGNC:HGNC:2459\|Ensembl:ENSG00000070770\|HPRD:00279\|Vega:OTTHUMG00000133488
Gene type	protein-coding
Map location	16q21
Pascal p-value	0.226
Sherlock p-value	0.918
Fetal beta	0.006
DMG	2 (# studies)
eGene	Myers' cis & trans

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Nishioka_2013	Genome-wide DNA methylation analysis	The authors investigated the methylation profiles of DNA in peripheral blood cells from 18 patients with first-episode schizophrenia (FESZ) and from 15 normal controls.	2
DMG:vanEijk_2014	Genome-wide DNA methylation analysis	This dataset includes 432 differentially methylated CpG sites corresponding to 391 unique transcripts between schizophrenia patients (n=260) and unaffected controls (n=250).	2
Network	Shortest path distance of core genes in the Human protein-protein interaction network	Contribution to shortest path in PPI network: 0.2826

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg24307225	16	58231550	CSNK2A2		-0.03	0.31	DMG:Nishioka_2013
cg08368934	16	57701455	CSNK2A2	1.28E-6	2.931		DMG:vanEijk_2014

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	pvalue	qvalue	TSS distance	eQTL type
rs11230726	chr11	61275103	CSNK2A2	1459		0.1		trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0000166	nucleotide binding	IEA		-
GO:0005524	ATP binding	IEA		-
GO:0004674	protein serine/threonine kinase activity	IEA		-
GO:0016740	transferase activity	IEA		-
GO:0047485	protein N-terminus binding	IPI		11972058
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0006468	protein amino acid phosphorylation	IEA		-
GO:0016055	Wnt receptor signaling pathway	IEA		-
GO:0051726	regulation of cell cycle	IEA		-

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
ARR3	ARRX	arrestin 3, retinal (X-arrestin)	Biochemical Activity	BioGRID	11877451
ATF1	EWS-ATF1 \| FUS/ATF-1 \| TREB36	activating transcription factor 1	-	HPRD,BioGRID	9685505
ATF2	CRE-BP1 \| CREB2 \| HB16 \| MGC111558 \| TREB7	activating transcription factor 2	-	HPRD,BioGRID	9685505
BRF1	BRF \| FLJ42674 \| FLJ43034 \| GTF3B \| MGC105048 \| TAF3B2 \| TAF3C \| TAFIII90 \| TF3B90 \| TFIIIB90 \| hBRF	BRF1 homolog, subunit of RNA polymerase III transcription initiation factor IIIB (S. cerevisiae)	Affinity Capture-Western	BioGRID	11997511
CREBBP	CBP \| KAT3A \| RSTS	CREB binding protein	-	HPRD,BioGRID	9685505
CSN3	CSN10 \| CSNK \| KCA	casein kappa	-	HPRD	11827172
CSNK2B	CK2B \| CK2N \| CSK2B \| G5A \| MGC138222 \| MGC138224	casein kinase 2, beta polypeptide	-	HPRD,BioGRID	9571630
CSNK2B	CK2B \| CK2N \| CSK2B \| G5A \| MGC138222 \| MGC138224	casein kinase 2, beta polypeptide	CK2-alpha' subunit interacts with CK2-beta subunit.	BIND	7768894
FGF1	AFGF \| ECGF \| ECGF-beta \| ECGFA \| ECGFB \| FGF-alpha \| FGFA \| GLIO703 \| HBGF1	fibroblast growth factor 1 (acidic)	-	HPRD,BioGRID	12145206
FGF2	BFGF \| FGFB \| HBGF-2	fibroblast growth factor 2 (basic)	Reconstituted Complex	BioGRID	12145206
FGF2	BFGF \| FGFB \| HBGF-2	fibroblast growth factor 2 (basic)	-	HPRD	7735329
FOS	AP-1 \| C-FOS	v-fos FBJ murine osteosarcoma viral oncogene homolog	-	HPRD,BioGRID	9685505
GDNF	ATF1 \| ATF2 \| HFB1-GDNF	glial cell derived neurotrophic factor	-	HPRD	9685505
HSP90AA1	FLJ31884 \| HSP86 \| HSP89A \| HSP90A \| HSP90N \| HSPC1 \| HSPCA \| HSPCAL1 \| HSPCAL4 \| HSPN \| Hsp89 \| Hsp90 \| LAP2	heat shock protein 90kDa alpha (cytosolic), class A member 1	-	HPRD,BioGRID	7794926
HSP90B1	ECGP \| GP96 \| GRP94 \| TRA1	heat shock protein 90kDa beta (Grp94), member 1	-	HPRD,BioGRID	11557039
JUN	AP-1 \| AP1 \| c-Jun	jun oncogene	Far Western Reconstituted Complex	BioGRID	9685505
KLF1	EKLF	Kruppel-like factor 1 (erythroid)	-	HPRD,BioGRID	9722526
MAPK14	CSBP1 \| CSBP2 \| CSPB1 \| EXIP \| Mxi2 \| PRKM14 \| PRKM15 \| RK \| SAPK2A \| p38 \| p38ALPHA	mitogen-activated protein kinase 14	-	HPRD	10747897
MGMT	-	O-6-methylguanine-DNA methyltransferase	Biochemical Activity	BioGRID	10667577
NAP1L4	MGC4565 \| NAP2 \| NAP2L \| hNAP2	nucleosome assembly protein 1-like 4	-	HPRD	10764593
NCL	C23 \| FLJ45706	nucleolin	Affinity Capture-Western Biochemical Activity Far Western	BioGRID	8663258
PAK1	MGC130000 \| MGC130001 \| PAKalpha	p21 protein (Cdc42/Rac)-activated kinase 1	-	HPRD	10938077
PIN1	DOD \| UBL5	peptidylprolyl cis/trans isomerase, NIMA-interacting 1	-	HPRD,BioGRID	11940573
PRNP	ASCR \| CD230 \| CJD \| GSS \| MGC26679 \| PRIP \| PrP \| PrP27-30 \| PrP33-35C \| PrPc \| prion	prion protein	PrPc interacts with CSNK2A2 (CK2 alpha prime). This interaction was modeled on a demonstrated interaction between bovine PrPc and human CSNK2A2 (CK2 alpha prime).	BIND	11062072
PTEN	10q23del \| BZS \| MGC11227 \| MHAM \| MMAC1 \| PTEN1 \| TEP1	phosphatase and tensin homolog	Biochemical Activity Reconstituted Complex	BioGRID	12297295
RELA	MGC131774 \| NFKB3 \| p65	v-rel reticuloendotheliosis viral oncogene homolog A (avian)	Affinity Capture-Western Biochemical Activity	BioGRID	10938077
RNPS1	E5.1 \| MGC117332	RNA binding protein S1, serine-rich domain	Affinity Capture-MS	BioGRID	17353931
TOP1	TOPI	topoisomerase (DNA) I	Biochemical Activity	BioGRID	2998765

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG WNT SIGNALING PATHWAY	151	112	All SZGR 2.0 genes in this pathway
KEGG ADHERENS JUNCTION	75	53	All SZGR 2.0 genes in this pathway
KEGG TIGHT JUNCTION	134	86	All SZGR 2.0 genes in this pathway
PID NFKAPPAB ATYPICAL PATHWAY	17	15	All SZGR 2.0 genes in this pathway
PID DNA PK PATHWAY	16	10	All SZGR 2.0 genes in this pathway
PID ECADHERIN NASCENT AJ PATHWAY	39	33	All SZGR 2.0 genes in this pathway
PID P38 ALPHA BETA DOWNSTREAM PATHWAY	38	29	All SZGR 2.0 genes in this pathway
REACTOME DEVELOPMENTAL BIOLOGY	396	292	All SZGR 2.0 genes in this pathway
REACTOME AXON GUIDANCE	251	188	All SZGR 2.0 genes in this pathway
REACTOME L1CAM INTERACTIONS	86	62	All SZGR 2.0 genes in this pathway
REACTOME SIGNAL TRANSDUCTION BY L1	34	25	All SZGR 2.0 genes in this pathway
ONKEN UVEAL MELANOMA DN	526	357	All SZGR 2.0 genes in this pathway
CHARAFE BREAST CANCER LUMINAL VS BASAL DN	455	304	All SZGR 2.0 genes in this pathway
MULLIGHAN NPM1 SIGNATURE 3 DN	162	116	All SZGR 2.0 genes in this pathway
SENESE HDAC3 TARGETS DN	536	332	All SZGR 2.0 genes in this pathway
PROVENZANI METASTASIS UP	194	112	All SZGR 2.0 genes in this pathway
ENK UV RESPONSE EPIDERMIS DN	508	354	All SZGR 2.0 genes in this pathway
BERENJENO TRANSFORMED BY RHOA UP	536	340	All SZGR 2.0 genes in this pathway
ROYLANCE BREAST CANCER 16Q COPY NUMBER UP	63	44	All SZGR 2.0 genes in this pathway
PUJANA BRCA1 PCC NETWORK	1652	1023	All SZGR 2.0 genes in this pathway
BUYTAERT PHOTODYNAMIC THERAPY STRESS UP	811	508	All SZGR 2.0 genes in this pathway
DEN INTERACT WITH LCA5	26	21	All SZGR 2.0 genes in this pathway
MAGRANGEAS MULTIPLE MYELOMA IGLL VS IGLK UP	42	24	All SZGR 2.0 genes in this pathway
SESTO RESPONSE TO UV C8	72	56	All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE INCIPIENT UP	390	242	All SZGR 2.0 genes in this pathway
KAYO AGING MUSCLE UP	244	165	All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE UP	1691	1088	All SZGR 2.0 genes in this pathway
MATZUK SPERMATOZOA	114	77	All SZGR 2.0 genes in this pathway
BHATI G2M ARREST BY 2METHOXYESTRADIOL DN	127	75	All SZGR 2.0 genes in this pathway
FIRESTEIN PROLIFERATION	175	125	All SZGR 2.0 genes in this pathway
HOSHIDA LIVER CANCER SUBCLASS S2	115	74	All SZGR 2.0 genes in this pathway
WANG RESPONSE TO GSK3 INHIBITOR SB216763 UP	397	206	All SZGR 2.0 genes in this pathway
LU EZH2 TARGETS DN	414	237	All SZGR 2.0 genes in this pathway
PILON KLF1 TARGETS DN	1972	1213	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-181	191	197	1A	hsa-miR-181a^brain	AACAUUCAACGCUGUCGGUGAGU
				hsa-miR-181b^SZ	AACAUUCAUUGCUGUCGGUGGG
				hsa-miR-181c^brain	AACAUUCAACCUGUCGGUGAGU
				hsa-miR-181d^brain	AACAUUCAUUGUUGUCGGUGGGUU
miR-208	70	77	1A,m8	hsa-miR-208	AUAAGACGAGCAAAAAGCUUGU
miR-23	256	263	1A,m8	hsa-miR-23a^brain	AUCACAUUGCCAGGGAUUUCC
miR-23	256	263	1A,m8	hsa-miR-23b^brain	AUCACAUUGCCAGGGAUUACC
miR-323	256	262	1A	hsa-miR-323^brain	GCACAUUACACGGUCGACCUCU
miR-346	105	111	1A	hsa-miR-346^brain	UGUCUGCCCGCAUGCCUGCCUCU
miR-433-5p	167	173	1A	hsa-miR-433-5p	UACGGUGAGCCUGUCAUUAUUC
miR-496	193	199	1A	hsa-miR-496	AUUACAUGGCCAAUCUC
miR-499	71	77	1A	hsa-miR-499	UUAAGACUUGCAGUGAUGUUUAA

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: CSNK2A2