Gene Page: CTNNA2
Summary ?
| GeneID | 1496 |
| Symbol | CTNNA2 |
| Synonyms | CAP-R|CAPR|CT114|CTNR |
| Description | catenin alpha 2 |
| Reference | MIM:114025|HGNC:HGNC:2510|Ensembl:ENSG00000066032|HPRD:00228|Vega:OTTHUMG00000152903 |
| Gene type | protein-coding |
| Map location | 2p12-p11.1 |
| Sherlock p-value | 0.215 |
| TADA p-value | 0.017 |
| Fetal beta | -1.603 |
| eGene | Meta |
| Support | INTRACELLULAR SIGNAL TRANSDUCTION G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-CONSENSUS G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-FULL G2Cdb.human_BAYES-COLLINS-MOUSE-PSD-CONSENSUS CompositeSet Potential synaptic genes |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| DNM:Fromer_2014 | Whole Exome Sequencing analysis | This study reported a WES study of 623 schizophrenia trios, reporting DNMs using genomic DNA. | |
| PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
| Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenias | Click to show details |
Section I. Genetics and epigenetics annotation
DNM table
| Gene | Chromosome | Position | Ref | Alt | Transcript | AA change | Mutation type | Sift | CG46 | Trait | Study |
|---|---|---|---|---|---|---|---|---|---|---|---|
| CTNNA2 | chr2 | 80136810 | G | A | NM_001164883 NM_004389 | p.315A>T p.315A>T | missense missense | Schizophrenia | DNM:Fromer_2014 |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0005515 | protein binding | IEA | - | |
| GO:0005198 | structural molecule activity | IEA | - | |
| GO:0005200 | structural constituent of cytoskeleton | NAS | 8432524 | |
| GO:0045296 | cadherin binding | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0007155 | cell adhesion | IEA | - | |
| GO:0007155 | cell adhesion | NAS | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005737 | cytoplasm | IEA | - | |
| GO:0005886 | plasma membrane | IEA | - | |
| GO:0015629 | actin cytoskeleton | IEA | - | |
| GO:0030054 | cell junction | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| KEGG ADHERENS JUNCTION | 75 | 53 | All SZGR 2.0 genes in this pathway |
| KEGG TIGHT JUNCTION | 134 | 86 | All SZGR 2.0 genes in this pathway |
| KEGG LEUKOCYTE TRANSENDOTHELIAL MIGRATION | 118 | 78 | All SZGR 2.0 genes in this pathway |
| KEGG PATHWAYS IN CANCER | 328 | 259 | All SZGR 2.0 genes in this pathway |
| KEGG ENDOMETRIAL CANCER | 52 | 45 | All SZGR 2.0 genes in this pathway |
| KEGG ARRHYTHMOGENIC RIGHT VENTRICULAR CARDIOMYOPATHY ARVC | 76 | 59 | All SZGR 2.0 genes in this pathway |
| BIOCARTA CELL2CELL PATHWAY | 14 | 11 | All SZGR 2.0 genes in this pathway |
| PIEPOLI LGI1 TARGETS UP | 15 | 11 | All SZGR 2.0 genes in this pathway |
| ZHOU INFLAMMATORY RESPONSE FIMA UP | 544 | 308 | All SZGR 2.0 genes in this pathway |
| ZHOU INFLAMMATORY RESPONSE LPS UP | 431 | 237 | All SZGR 2.0 genes in this pathway |
| SMITH LIVER CANCER | 45 | 27 | All SZGR 2.0 genes in this pathway |
| BYSTRYKH HEMATOPOIESIS STEM CELL QTL TRANS | 882 | 572 | All SZGR 2.0 genes in this pathway |
| BLALOCK ALZHEIMERS DISEASE DN | 1237 | 837 | All SZGR 2.0 genes in this pathway |
| ULE SPLICING VIA NOVA2 | 43 | 38 | All SZGR 2.0 genes in this pathway |
| BROWNE HCMV INFECTION 48HR UP | 180 | 125 | All SZGR 2.0 genes in this pathway |
| CHENG IMPRINTED BY ESTRADIOL | 110 | 68 | All SZGR 2.0 genes in this pathway |
| MOLENAAR TARGETS OF CCND1 AND CDK4 UP | 67 | 48 | All SZGR 2.0 genes in this pathway |
| BOYAULT LIVER CANCER SUBCLASS G6 UP | 65 | 43 | All SZGR 2.0 genes in this pathway |
| CHIANG LIVER CANCER SUBCLASS CTNNB1 UP | 176 | 110 | All SZGR 2.0 genes in this pathway |
| BROWNE HCMV INFECTION 30MIN UP | 56 | 38 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-183 | 597 | 603 | m8 | hsa-miR-183 | UAUGGCACUGGUAGAAUUCACUG |
| miR-363 | 430 | 436 | 1A | hsa-miR-363 | AUUGCACGGUAUCCAUCUGUAA |
| miR-409-3p | 233 | 239 | m8 | hsa-miR-409-3p | CGAAUGUUGCUCGGUGAACCCCU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.