Gene Page: SEPT10
Summary ?
GeneID | 151011 |
Symbol | SEPT10 |
Synonyms | - |
Description | septin 10 |
Reference | MIM:611737|HGNC:HGNC:14349|Ensembl:ENSG00000186522|HPRD:15325|Vega:OTTHUMG00000154957 |
Gene type | protein-coding |
Map location | 2q13 |
Pascal p-value | 3.763E-5 |
Sherlock p-value | 0.366 |
eGene | Myers' cis & trans |
Support | G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-CONSENSUS CompositeSet |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:GWASdb | Genome-wide Association Studies | GWASdb records for schizophrenia | |
CV:PGCnp | Genome-wide Association Study | GWAS | |
GSMA_I | Genome scan meta-analysis | Psr: 0.0004 | |
GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.00755 |
Section I. Genetics and epigenetics annotation
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs10799319 | chr1 | 225703484 | SEPT10 | 151011 | 0.16 | trans | ||
rs17730330 | chr12 | 92998513 | SEPT10 | 151011 | 0.16 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0000166 | nucleotide binding | IEA | - | |
GO:0005515 | protein binding | IEA | - | |
GO:0005525 | GTP binding | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0007049 | cell cycle | IEA | - | |
GO:0051301 | cell division | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005634 | nucleus | IEA | - | |
GO:0005737 | cytoplasm | IEA | - | |
GO:0031105 | septin complex | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
PICCALUGA ANGIOIMMUNOBLASTIC LYMPHOMA UP | 205 | 140 | All SZGR 2.0 genes in this pathway |
ONKEN UVEAL MELANOMA UP | 783 | 507 | All SZGR 2.0 genes in this pathway |
FOURNIER ACINAR DEVELOPMENT EARLY UP | 21 | 19 | All SZGR 2.0 genes in this pathway |
THUM SYSTOLIC HEART FAILURE UP | 423 | 283 | All SZGR 2.0 genes in this pathway |
HUTTMANN B CLL POOR SURVIVAL UP | 276 | 187 | All SZGR 2.0 genes in this pathway |
CHARAFE BREAST CANCER LUMINAL VS BASAL DN | 455 | 304 | All SZGR 2.0 genes in this pathway |
HORIUCHI WTAP TARGETS DN | 310 | 188 | All SZGR 2.0 genes in this pathway |
BILBAN B CLL LPL UP | 63 | 39 | All SZGR 2.0 genes in this pathway |
TONKS TARGETS OF RUNX1 RUNX1T1 FUSION HSC UP | 185 | 126 | All SZGR 2.0 genes in this pathway |
KINSEY TARGETS OF EWSR1 FLII FUSION UP | 1278 | 748 | All SZGR 2.0 genes in this pathway |
RODRIGUES THYROID CARCINOMA POORLY DIFFERENTIATED UP | 633 | 376 | All SZGR 2.0 genes in this pathway |
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN | 1781 | 1082 | All SZGR 2.0 genes in this pathway |
SCHAEFFER PROSTATE DEVELOPMENT 6HR DN | 514 | 330 | All SZGR 2.0 genes in this pathway |
GEORGES CELL CYCLE MIR192 TARGETS | 62 | 46 | All SZGR 2.0 genes in this pathway |
SHEN SMARCA2 TARGETS UP | 424 | 268 | All SZGR 2.0 genes in this pathway |
FLECHNER BIOPSY KIDNEY TRANSPLANT REJECTED VS OK DN | 546 | 351 | All SZGR 2.0 genes in this pathway |
FLECHNER BIOPSY KIDNEY TRANSPLANT OK VS DONOR UP | 555 | 346 | All SZGR 2.0 genes in this pathway |
HASLINGER B CLL WITH MUTATED VH GENES | 18 | 14 | All SZGR 2.0 genes in this pathway |
BURTON ADIPOGENESIS 10 | 30 | 17 | All SZGR 2.0 genes in this pathway |
LU AGING BRAIN UP | 262 | 186 | All SZGR 2.0 genes in this pathway |
DAZARD RESPONSE TO UV SCC UP | 123 | 75 | All SZGR 2.0 genes in this pathway |
BAELDE DIABETIC NEPHROPATHY DN | 434 | 302 | All SZGR 2.0 genes in this pathway |
DE YY1 TARGETS DN | 92 | 64 | All SZGR 2.0 genes in this pathway |
AMBROSINI FLAVOPIRIDOL TREATMENT TP53 | 109 | 63 | All SZGR 2.0 genes in this pathway |
BOHN PRIMARY IMMUNODEFICIENCY SYNDROM UP | 47 | 30 | All SZGR 2.0 genes in this pathway |
GUTIERREZ MULTIPLE MYELOMA UP | 35 | 24 | All SZGR 2.0 genes in this pathway |
YAO TEMPORAL RESPONSE TO PROGESTERONE CLUSTER 15 | 35 | 23 | All SZGR 2.0 genes in this pathway |
JOHNSTONE PARVB TARGETS 3 DN | 918 | 550 | All SZGR 2.0 genes in this pathway |
ZWANG CLASS 1 TRANSIENTLY INDUCED BY EGF | 516 | 308 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-124/506 | 1182 | 1189 | 1A,m8 | hsa-miR-506 | UAAGGCACCCUUCUGAGUAGA |
hsa-miR-124brain | UAAGGCACGCGGUGAAUGCC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.