Summary ?
GeneID151195
SymbolCCNYL1
Synonyms-
Descriptioncyclin Y like 1
ReferenceHGNC:HGNC:26868|Ensembl:ENSG00000163249|HPRD:08809|Vega:OTTHUMG00000132946
Gene typeprotein-coding
Map location2q33.3
Pascal p-value0.023

Gene in Data Sources
Gene set name Method of gene setDescriptionInfo
CV:PGCnpGenome-wide Association StudyGWAS
GSMA_IIAGenome scan meta-analysis (All samples)Psr: 0.00916 
GSMA_IIEGenome scan meta-analysis (European-ancestry samples)Psr: 0.01016 

Section I. Genetics and epigenetics annotation


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section V. Pathway annotation

Pathway namePathway size# SZGR 2.0 genes in pathwayInfo
CHARAFE BREAST CANCER LUMINAL VS BASAL DN 455304All SZGR 2.0 genes in this pathway
NUYTTEN EZH2 TARGETS UP 1037673All SZGR 2.0 genes in this pathway
CREIGHTON ENDOCRINE THERAPY RESISTANCE 5 482296All SZGR 2.0 genes in this pathway
MASSARWEH TAMOXIFEN RESISTANCE UP 578341All SZGR 2.0 genes in this pathway
CAMPS COLON CANCER COPY NUMBER UP 9245All SZGR 2.0 genes in this pathway
LEE BMP2 TARGETS DN 882538All SZGR 2.0 genes in this pathway
TORCHIA TARGETS OF EWSR1 FLI1 FUSION DN 321200All SZGR 2.0 genes in this pathway
KATSANOU ELAVL1 TARGETS DN 14888All SZGR 2.0 genes in this pathway
PEDERSEN METASTASIS BY ERBB2 ISOFORM 4 11066All SZGR 2.0 genes in this pathway
FORTSCHEGGER PHF8 TARGETS UP 279155All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-103/1074034091Ahsa-miR-103brainAGCAGCAUUGUACAGGGCUAUGA
hsa-miR-107brainAGCAGCAUUGUACAGGGCUAUCA
miR-1222322381Ahsa-miR-122aUGGAGUGUGACAAUGGUGUUUGU
miR-140228234m8hsa-miR-140brainAGUGGUUUUACCCUAUGGUAG
miR-15/16/195/424/4975335391Ahsa-miR-15abrainUAGCAGCACAUAAUGGUUUGUG
hsa-miR-16brainUAGCAGCACGUAAAUAUUGGCG
hsa-miR-15bbrainUAGCAGCACAUCAUGGUUUACA
hsa-miR-195SZUAGCAGCACAGAAAUAUUGGC
hsa-miR-424CAGCAGCAAUUCAUGUUUUGAA
hsa-miR-497CAGCAGCACACUGUGGUUUGU
miR-200bc/4294294361A,m8hsa-miR-200bUAAUACUGCCUGGUAAUGAUGAC
hsa-miR-200cUAAUACUGCCGGGUAAUGAUGG
hsa-miR-429UAAUACUGUCUGGUAAAACCGU
miR-29712718m8hsa-miR-29aSZUAGCACCAUCUGAAAUCGGUU
hsa-miR-29bSZUAGCACCAUUUGAAAUCAGUGUU
hsa-miR-29cSZUAGCACCAUUUGAAAUCGGU
miR-5035335391Ahsa-miR-503UAGCAGCGGGAACAGUUCUGCAG