SZGR2

Summary ?

GeneID	161357
Symbol	MDGA2
Synonyms	MAMDC1\|c14_5286
Description	MAM domain containing glycosylphosphatidylinositol anchor 2
Reference	MIM:611128\|HGNC:HGNC:19835\|Ensembl:ENSG00000139915\|HPRD:14352\|Vega:OTTHUMG00000029429
Gene type	protein-coding
Map location	14q21.3
Pascal p-value	4.236E-4
Fetal beta	-0.246
DMG	2 (# studies)

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Jaffe_2016	Genome-wide DNA methylation analysis	This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05.	2
DMG:Wockner_2014	Genome-wide DNA methylation analysis	This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24).	2
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias	Click to show details
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 1

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg13687915	14	47311141	MDGA2	3.696E-4	-0.628	0.043	DMG:Wockner_2014
cg18115064	14	48143618	MDGA2	4.58E-10	-0.022	8.11E-7	DMG:Jaffe_2016

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section III. Gene Ontology annotation

Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0021522	spinal cord motor neuron differentiation	ISS	neuron, Brain (GO term level: 9)	15019943
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005737	cytoplasm	IDA		18029348
GO:0005886	plasma membrane	IEA		-
GO:0031225	anchored to membrane	IEA		-

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
TAKADA GASTRIC CANCER COPY NUMBER DN	29	15	All SZGR 2.0 genes in this pathway
DAWSON METHYLATED IN LYMPHOMA TCL1	59	45	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-10	437	444	1A,m8	hsa-miR-10a	UACCCUGUAGAUCCGAAUUUGUG
miR-10	437	444	1A,m8	hsa-miR-10b	UACCCUGUAGAACCGAAUUUGU
miR-124/506	817	823	m8	hsa-miR-506	UAAGGCACCCUUCUGAGUAGA
miR-124/506	817	823	m8	hsa-miR-124^brain	UAAGGCACGCGGUGAAUGCC
miR-129-5p	1409	1415	1A	hsa-miR-129^brain	CUUUUUGCGGUCUGGGCUUGC
miR-129-5p	1409	1415	1A	hsa-miR-129-5p	CUUUUUGCGGUCUGGGCUUGCU
miR-130/301	861	867	m8	hsa-miR-130a^brain	CAGUGCAAUGUUAAAAGGGCAU
				hsa-miR-301	CAGUGCAAUAGUAUUGUCAAAGC
				hsa-miR-130b^brain	CAGUGCAAUGAUGAAAGGGCAU
				hsa-miR-454-3p	UAGUGCAAUAUUGCUUAUAGGGUUU
miR-139	1752	1758	1A	hsa-miR-139^brain	UCUACAGUGCACGUGUCU
miR-140	781	787	m8	hsa-miR-140^brain	AGUGGUUUUACCCUAUGGUAG
miR-148/152	862	868	m8	hsa-miR-148a	UCAGUGCACUACAGAACUUUGU
				hsa-miR-152^brain	UCAGUGCAUGACAGAACUUGGG
				hsa-miR-148b	UCAGUGCAUCACAGAACUUUGU
miR-153	1643	1649	1A	hsa-miR-153	UUGCAUAGUCACAAAAGUGA
miR-200bc/429	1664	1670	1A	hsa-miR-200b	UAAUACUGCCUGGUAAUGAUGAC
				hsa-miR-200c	UAAUACUGCCGGGUAAUGAUGG
				hsa-miR-429	UAAUACUGUCUGGUAAAACCGU
miR-21	634	640	1A	hsa-miR-21^brain	UAGCUUAUCAGACUGAUGUUGA
miR-21	634	640	1A	hsa-miR-590	GAGCUUAUUCAUAAAAGUGCAG
miR-218	1700	1707	1A,m8	hsa-miR-218^brain	UUGUGCUUGAUCUAACCAUGU
miR-218	1700	1707	1A,m8	hsa-miR-218^brain	UUGUGCUUGAUCUAACCAUGU
miR-299-5p	687	693	m8	hsa-miR-299-5p	UGGUUUACCGUCCCACAUACAU
miR-30-3p	1289	1295	1A	hsa-miR-30a-3p	CUUUCAGUCGGAUGUUUGCAGC
miR-30-3p	1289	1295	1A	hsa-miR-30e-3p	CUUUCAGUCGGAUGUUUACAGC
miR-33	1483	1489	m8	hsa-miR-33	GUGCAUUGUAGUUGCAUUG
miR-33	1483	1489	m8	hsa-miR-33b	GUGCAUUGCUGUUGCAUUGCA
miR-363	1766	1772	1A	hsa-miR-363	AUUGCACGGUAUCCAUCUGUAA
				hsa-miR-363	AUUGCACGGUAUCCAUCUGUAA
				hsa-miR-363	AUUGCACGGUAUCCAUCUGUAA
miR-380-5p	1120	1127	1A,m8	hsa-miR-380-5p	UGGUUGACCAUAGAACAUGCGC
miR-380-5p	1120	1127	1A,m8	hsa-miR-563	AGGUUGACAUACGUUUCCC
miR-382	1783	1789	1A	hsa-miR-382^brain	GAAGUUGUUCGUGGUGGAUUCG
miR-448	1643	1649	1A	hsa-miR-448	UUGCAUAUGUAGGAUGUCCCAU
miR-490	1104	1111	1A,m8	hsa-miR-490	CAACCUGGAGGACUCCAUGCUG
miR-494	368	374	1A	hsa-miR-494^brain	UGAAACAUACACGGGAAACCUCUU
miR-7	1100	1106	1A	hsa-miR-7^SZ	UGGAAGACUAGUGAUUUUGUUG
miR-9	87	94	1A,m8	hsa-miR-9^SZ	UCUUUGGUUAUCUAGCUGUAUGA

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: MDGA2