Gene Page: DES
Summary ?
| GeneID | 1674 |
| Symbol | DES |
| Synonyms | CSM1|CSM2|LGMD2R |
| Description | desmin |
| Reference | MIM:125660|HGNC:HGNC:2770|Ensembl:ENSG00000175084|HPRD:00514|Vega:OTTHUMG00000058924 |
| Gene type | protein-coding |
| Map location | 2q35 |
| Pascal p-value | 0.226 |
| Fetal beta | -0.342 |
| Support | G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-FULL G2Cdb.human_BAYES-COLLINS-MOUSE-PSD-CONSENSUS |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
| GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.00916 | |
| GSMA_IIE | Genome scan meta-analysis (European-ancestry samples) | Psr: 0.01016 | |
| Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenics,schizotypy,schizophrenias,schizotypal | Click to show details |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0005515 | protein binding | IEA | - | |
| GO:0005200 | structural constituent of cytoskeleton | TAS | 9736733 | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0007010 | cytoskeleton organization | TAS | 9736733 | |
| GO:0008016 | regulation of heart contraction | TAS | 9697706 | |
| GO:0006936 | muscle contraction | TAS | 9697706 | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0045202 | synapse | IEA | neuron, Synap, Neurotransmitter, Glial (GO term level: 2) | - |
| GO:0005856 | cytoskeleton | IEA | - | |
| GO:0005882 | intermediate filament | TAS | 9736733 | |
| GO:0005626 | insoluble fraction | IEA | - | |
| GO:0005737 | cytoplasm | IEA | - | |
| GO:0030018 | Z disc | IDA | 9415431 | |
| GO:0042383 | sarcolemma | IEA | - | |
| GO:0043292 | contractile fiber | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| KEGG HYPERTROPHIC CARDIOMYOPATHY HCM | 85 | 65 | All SZGR 2.0 genes in this pathway |
| KEGG ARRHYTHMOGENIC RIGHT VENTRICULAR CARDIOMYOPATHY ARVC | 76 | 59 | All SZGR 2.0 genes in this pathway |
| KEGG DILATED CARDIOMYOPATHY | 92 | 68 | All SZGR 2.0 genes in this pathway |
| PID AURORA B PATHWAY | 39 | 24 | All SZGR 2.0 genes in this pathway |
| REACTOME STRIATED MUSCLE CONTRACTION | 27 | 12 | All SZGR 2.0 genes in this pathway |
| REACTOME MUSCLE CONTRACTION | 48 | 24 | All SZGR 2.0 genes in this pathway |
| PARENT MTOR SIGNALING UP | 567 | 375 | All SZGR 2.0 genes in this pathway |
| WILCOX RESPONSE TO PROGESTERONE DN | 66 | 44 | All SZGR 2.0 genes in this pathway |
| EBAUER TARGETS OF PAX3 FOXO1 FUSION UP | 207 | 128 | All SZGR 2.0 genes in this pathway |
| HUMMERICH SKIN CANCER PROGRESSION DN | 100 | 64 | All SZGR 2.0 genes in this pathway |
| EBAUER MYOGENIC TARGETS OF PAX3 FOXO1 FUSION | 50 | 26 | All SZGR 2.0 genes in this pathway |
| OHASHI AURKB TARGETS | 10 | 6 | All SZGR 2.0 genes in this pathway |
| SCHLESINGER H3K27ME3 IN NORMAL AND METHYLATED IN CANCER | 28 | 21 | All SZGR 2.0 genes in this pathway |
| RICKMAN HEAD AND NECK CANCER F | 54 | 32 | All SZGR 2.0 genes in this pathway |
| REN ALVEOLAR RHABDOMYOSARCOMA UP | 98 | 64 | All SZGR 2.0 genes in this pathway |
| KAYO CALORIE RESTRICTION MUSCLE UP | 95 | 64 | All SZGR 2.0 genes in this pathway |
| SMID BREAST CANCER NORMAL LIKE UP | 476 | 285 | All SZGR 2.0 genes in this pathway |
| WEST ADRENOCORTICAL CARCINOMA VS ADENOMA UP | 21 | 13 | All SZGR 2.0 genes in this pathway |
| MEISSNER NPC HCP WITH H3 UNMETHYLATED | 536 | 296 | All SZGR 2.0 genes in this pathway |
| MEISSNER BRAIN HCP WITH H3 UNMETHYLATED | 37 | 21 | All SZGR 2.0 genes in this pathway |
| MIKKELSEN MEF HCP WITH H3K27ME3 | 590 | 403 | All SZGR 2.0 genes in this pathway |
| ZEMBUTSU SENSITIVITY TO CISPLATIN | 20 | 14 | All SZGR 2.0 genes in this pathway |
| ZEMBUTSU SENSITIVITY TO DOXORUBICIN | 17 | 10 | All SZGR 2.0 genes in this pathway |
| BRUINS UVC RESPONSE VIA TP53 GROUP C | 92 | 60 | All SZGR 2.0 genes in this pathway |
| ACEVEDO FGFR1 TARGETS IN PROSTATE CANCER MODEL DN | 308 | 187 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-370 | 577 | 583 | 1A | hsa-miR-370brain | GCCUGCUGGGGUGGAACCUGG |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.