Gene Page: ARX
Summary ?
| GeneID | 170302 |
| Symbol | ARX |
| Synonyms | CT121|EIEE1|ISSX|MRX29|MRX32|MRX33|MRX36|MRX38|MRX43|MRX54|MRX76|MRX87|MRXS1|PRTS |
| Description | aristaless related homeobox |
| Reference | MIM:300382|HGNC:HGNC:18060|Ensembl:ENSG00000004848|HPRD:02307|Vega:OTTHUMG00000021275 |
| Gene type | protein-coding |
| Map location | Xp21.3 |
| Fetal beta | 0.327 |
| eGene | Myers' cis & trans |
| Support | Potential synaptic genes |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
| Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
| GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 7 |
Section I. Genetics and epigenetics annotation
eQTL annotation
| SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
|---|---|---|---|---|---|---|---|---|
| rs319490 | chr1 | 118281893 | ARX | 170302 | 0.08 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0003700 | transcription factor activity | IEA | - | |
| GO:0043565 | sequence-specific DNA binding | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0021759 | globus pallidus development | IEA | Brain (GO term level: 10) | - |
| GO:0007411 | axon guidance | IEA | axon (GO term level: 13) | - |
| GO:0001764 | neuron migration | IEA | neuron (GO term level: 8) | - |
| GO:0030900 | forebrain development | IEA | Brain (GO term level: 8) | - |
| GO:0021853 | cerebral cortex GABAergic interneuron migration | IEA | neuron, GABA (GO term level: 14) | - |
| GO:0007399 | nervous system development | IEA | neurite (GO term level: 5) | - |
| GO:0021800 | cerebral cortex tangential migration | IEA | Glial (GO term level: 13) | - |
| GO:0006355 | regulation of transcription, DNA-dependent | IEA | - | |
| GO:0007275 | multicellular organismal development | IEA | - | |
| GO:0030154 | cell differentiation | IEA | - | |
| GO:0042127 | regulation of cell proliferation | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005634 | nucleus | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| LU TUMOR VASCULATURE DN | 13 | 6 | All SZGR 2.0 genes in this pathway |
| VECCHI GASTRIC CANCER ADVANCED VS EARLY DN | 138 | 70 | All SZGR 2.0 genes in this pathway |
| BIDUS METASTASIS UP | 214 | 134 | All SZGR 2.0 genes in this pathway |
| DODD NASOPHARYNGEAL CARCINOMA UP | 1821 | 933 | All SZGR 2.0 genes in this pathway |
| RIZ ERYTHROID DIFFERENTIATION 12HR | 43 | 35 | All SZGR 2.0 genes in this pathway |
| PEREZ TP53 TARGETS | 1174 | 695 | All SZGR 2.0 genes in this pathway |
| PEREZ TP63 TARGETS | 355 | 243 | All SZGR 2.0 genes in this pathway |
| PEREZ TP53 AND TP63 TARGETS | 205 | 145 | All SZGR 2.0 genes in this pathway |
| GROSS HYPOXIA VIA HIF1A DN | 110 | 78 | All SZGR 2.0 genes in this pathway |
| GROSS HYPOXIA VIA ELK3 AND HIF1A UP | 142 | 104 | All SZGR 2.0 genes in this pathway |
| TSENG IRS1 TARGETS UP | 113 | 71 | All SZGR 2.0 genes in this pathway |
| SANSOM APC TARGETS REQUIRE MYC | 210 | 123 | All SZGR 2.0 genes in this pathway |
| SANSOM WNT PATHWAY REQUIRE MYC | 58 | 43 | All SZGR 2.0 genes in this pathway |
| HUANG DASATINIB RESISTANCE DN | 69 | 44 | All SZGR 2.0 genes in this pathway |
| ZHOU PANCREATIC ENDOCRINE PROGENITOR | 14 | 11 | All SZGR 2.0 genes in this pathway |
| MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3 | 1069 | 729 | All SZGR 2.0 genes in this pathway |
| MIKKELSEN MCV6 HCP WITH H3K27ME3 | 435 | 318 | All SZGR 2.0 genes in this pathway |
| MIKKELSEN IPS WITH HCP H3K27ME3 | 102 | 76 | All SZGR 2.0 genes in this pathway |
| MIKKELSEN ES HCP WITH H3K27ME3 | 41 | 30 | All SZGR 2.0 genes in this pathway |
| MIKKELSEN MEF HCP WITH H3 UNMETHYLATED | 228 | 119 | All SZGR 2.0 genes in this pathway |
| BRUINS UVC RESPONSE VIA TP53 GROUP B | 549 | 316 | All SZGR 2.0 genes in this pathway |
| RAO BOUND BY SALL4 ISOFORM A | 182 | 108 | All SZGR 2.0 genes in this pathway |
| ZWANG TRANSIENTLY UP BY 1ST EGF PULSE ONLY | 1839 | 928 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-34/449 | 225 | 231 | 1A | hsa-miR-34abrain | UGGCAGUGUCUUAGCUGGUUGUU |
| hsa-miR-34c | AGGCAGUGUAGUUAGCUGAUUGC | ||||
| hsa-miR-449 | UGGCAGUGUAUUGUUAGCUGGU | ||||
| hsa-miR-449b | AGGCAGUGUAUUGUUAGCUGGC | ||||
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.