SZGR2

Summary ?

GeneID	1740
Symbol	DLG2
Synonyms	PPP1R58\|PSD-93\|PSD93\|chapsyn-110
Description	discs large homolog 2
Reference	MIM:603583\|HGNC:HGNC:2901\|Ensembl:ENSG00000150672\|HPRD:04663\|HPRD:08220\|Vega:OTTHUMG00000134309
Gene type	protein-coding
Map location	11q14.1
TADA p-value	0.002
Fetal beta	-0.096
DMG	1 (# studies)
Support	PROTEIN CLUSTERING G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-CONSENSUS G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-FULL G2Cdb.human_BAYES-COLLINS-MOUSE-PSD-CONSENSUS G2Cdb.human_clathrin G2Cdb.human_PocklingtonH1 G2Cdb.human_Synaptosome G2Cdb.human_TAP-PSD-95-CORE G2Cdb.humanNRC G2Cdb.humanPSD G2Cdb.humanPSP CompositeSet Darnell FMRP targets Potential synaptic genes

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:GWASdb	Genome-wide Association Studies	GWASdb records for schizophrenia
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Wockner_2014	Genome-wide DNA methylation analysis	This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24).	2
DNM:Fromer_2014	Whole Exome Sequencing analysis	This study reported a WES study of 623 schizophrenia trios, reporting DNMs using genomic DNA.
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenias	Click to show details
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 1
Network	Shortest path distance of core genes in the Human protein-protein interaction network	Contribution to shortest path in PPI network: 0.2135

Section I. Genetics and epigenetics annotation

DNM table

Gene	Chromosome	Position	Ref	Alt	Transcript	AA change	Mutation type	Sift	CG46	Trait	Study
DLG2	chr11	83194295	C	T	NM_001142699 NM_001142700 NM_001142700 NM_001142702 NM_001142702 NM_001206769 NM_001364	. . . . . . .	intronic intronic splice-donor-in2 intronic splice-donor-in2 intronic intronic			Schizophrenia	DNM:Fromer_2014

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg16986720	11	84634735	DLG2	3.415E-4	0.434	0.041	DMG:Wockner_2014
cg10901805	11	84634620	DLG2	4.157E-4	0.675	0.044	DMG:Wockner_2014

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005515	protein binding	IPI		15304517 \|16192269
GO:0004385	guanylate kinase activity	TAS		8755482
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0045211	postsynaptic membrane	IEA	Synap, Neurotransmitter (GO term level: 5)	-
GO:0045202	synapse	IEA	neuron, Synap, Neurotransmitter, Glial (GO term level: 2)	-
GO:0005886	plasma membrane	TAS		8755482
GO:0030054	cell junction	IEA		-

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
ATP2B2	PMCA2 \| PMCA2a \| PMCA2i	ATPase, Ca++ transporting, plasma membrane 2	PMCA2b interacts with SAP93. This interaction was modeled on a demonstrated interaction between human PMCA2b and SAP93 from rat and an unspecified source.	BIND	11274188
ATP2B2	PMCA2 \| PMCA2a \| PMCA2i	ATPase, Ca++ transporting, plasma membrane 2	-	HPRD,BioGRID	11274188
ATP2B4	ATP2B2 \| DKFZp686G08106 \| DKFZp686M088 \| MXRA1 \| PMCA4 \| PMCA4b \| PMCA4x	ATPase, Ca++ transporting, plasma membrane 4	-	HPRD,BioGRID	11274188
ATP2B4	ATP2B2 \| DKFZp686G08106 \| DKFZp686M088 \| MXRA1 \| PMCA4 \| PMCA4b \| PMCA4x	ATPase, Ca++ transporting, plasma membrane 4	PMCA4b interacts with SAP93. This interaction was modeled on a demonstrated interaction between human PMCA4b and SAP93 from rat and an unspecified source.	BIND	11274188
CRIPT	HSPC139	cysteine-rich PDZ-binding protein	-	HPRD	9581762 \|12070168
DLG1	DKFZp761P0818 \| DKFZp781B0426 \| DLGH1 \| SAP97 \| dJ1061C18.1.1 \| hdlg	discs, large homolog 1 (Drosophila)	-	HPRD,BioGRID	12351654
DLG4	FLJ97752 \| FLJ98574 \| PSD95 \| SAP90	discs, large homolog 4 (Drosophila)	-	HPRD,BioGRID	9182804
DLGAP1	DAP-1 \| DAP-1-ALPHA \| DAP-1-BETA \| GKAP \| MGC88156 \| SAPAP1 \| hGKAP	discs, large (Drosophila) homolog-associated protein 1	DAP-1 interacts with Chapsyn-110.	BIND	11122378
DLGAP1	DAP-1 \| DAP-1-ALPHA \| DAP-1-BETA \| GKAP \| MGC88156 \| SAPAP1 \| hGKAP	discs, large (Drosophila) homolog-associated protein 1	Affinity Capture-Western	BioGRID	10844022
DYNLL1	DLC1 \| DLC8 \| DNCL1 \| DNCLC1 \| LC8 \| LC8a \| MGC126137 \| MGC126138 \| PIN \| hdlc1	dynein, light chain, LC8-type 1	Affinity Capture-Western	BioGRID	10844022
DYNLL2	DNCL1B \| Dlc2 \| MGC17810	dynein, light chain, LC8-type 2	Affinity Capture-Western	BioGRID	10844022
ERBB4	HER4 \| MGC138404 \| p180erbB4	v-erb-a erythroblastic leukemia viral oncogene homolog 4 (avian)	-	HPRD,BioGRID	10725395
ERBB4	HER4 \| MGC138404 \| p180erbB4	v-erb-a erythroblastic leukemia viral oncogene homolog 4 (avian)	ErbB-4 interacts with CHAPSYN-110.	BIND	10725395
GRIN1	NMDA1 \| NMDAR1 \| NR1	glutamate receptor, ionotropic, N-methyl D-aspartate 1	-	HPRD	10862698
GRIN2A	NMDAR2A \| NR2A	glutamate receptor, ionotropic, N-methyl D-aspartate 2A	-	HPRD	10648730
GRIN2A	NMDAR2A \| NR2A	glutamate receptor, ionotropic, N-methyl D-aspartate 2A	Two-hybrid	BioGRID	9278515
GRIN2B	MGC142178 \| MGC142180 \| NMDAR2B \| NR2B \| hNR3	glutamate receptor, ionotropic, N-methyl D-aspartate 2B	Affinity Capture-Western Two-hybrid	BioGRID	9278515 \|11997254
GRIN2B	MGC142178 \| MGC142180 \| NMDAR2B \| NR2B \| hNR3	glutamate receptor, ionotropic, N-methyl D-aspartate 2B	-	HPRD	9806853 \|11997254
GUCY1A2	GC-SA2 \| GUC1A2	guanylate cyclase 1, soluble, alpha 2	-	HPRD,BioGRID	11572861
KCNA4	HBK4 \| HK1 \| HPCN2 \| HUKII \| KCNA4L \| KCNA8 \| KV1.4 \| PCN2	potassium voltage-gated channel, shaker-related subfamily, member 4	-	HPRD,BioGRID	11997254
KCNJ12	FLJ14167 \| IRK2 \| KCNJN1 \| Kir2.2 \| Kir2.2v \| hIRK \| hIRK1 \| hkir2.2x \| kcnj12x	potassium inwardly-rectifying channel, subfamily J, member 12	-	HPRD,BioGRID	15024025
KCNJ4	HIR \| HIRK2 \| HRK1 \| IRK3 \| Kir2.3 \| MGC142066 \| MGC142068	potassium inwardly-rectifying channel, subfamily J, member 4	Affinity Capture-Western	BioGRID	11997254
LIN7A	LIN-7A \| LIN7 \| MALS-1 \| MGC148143 \| TIP-33 \| VELI1	lin-7 homolog A (C. elegans)	-	HPRD,BioGRID	9753324
LRP2	DBS \| gp330	low density lipoprotein-related protein 2	-	HPRD,BioGRID	12713445
MAP1A	FLJ77111 \| MAP1L \| MTAP1A	microtubule-associated protein 1A	-	HPRD	9786987
NLGN1	KIAA1070 \| MGC45115	neuroligin 1	Two-hybrid	BioGRID	9278515
NLGN2	KIAA1366	neuroligin 2	Two-hybrid	BioGRID	9278515
NLGN3	ASPGX1 \| AUTSX1 \| HNL3 \| KIAA1480	neuroligin 3	-	HPRD,BioGRID	9278515
NOS1	IHPS1 \| NOS \| nNOS	nitric oxide synthase 1 (neuronal)	-	HPRD,BioGRID	8625413
SEMA4C	FLJ20369 \| KIAA1739 \| M-SEMA-F \| MGC126382 \| MGC126383 \| SEMACL1 \| SEMAF \| SEMAI	sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4C	Two-hybrid	BioGRID	11134026

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
DELYS THYROID CANCER DN	232	154	All SZGR 2.0 genes in this pathway
SILIGAN TARGETS OF EWS FLI1 FUSION DN	18	9	All SZGR 2.0 genes in this pathway
PATIL LIVER CANCER	747	453	All SZGR 2.0 genes in this pathway
STARK HYPPOCAMPUS 22Q11 DELETION UP	53	40	All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE DN	1237	837	All SZGR 2.0 genes in this pathway
SAFFORD T LYMPHOCYTE ANERGY	87	54	All SZGR 2.0 genes in this pathway
RIGGI EWING SARCOMA PROGENITOR UP	430	288	All SZGR 2.0 genes in this pathway
FIRESTEIN PROLIFERATION	175	125	All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS UP	1305	895	All SZGR 2.0 genes in this pathway
TAVAZOIE METASTASIS	108	68	All SZGR 2.0 genes in this pathway
YAGI AML WITH INV 16 TRANSLOCATION	422	277	All SZGR 2.0 genes in this pathway
MIKKELSEN MEF ICP WITH H3K27ME3	206	108	All SZGR 2.0 genes in this pathway
ZWANG TRANSIENTLY UP BY 1ST EGF PULSE ONLY	1839	928	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-1/206	4600	4606	1A	hsa-miR-1	UGGAAUGUAAAGAAGUAUGUA
				hsa-miR-206^SZ	UGGAAUGUAAGGAAGUGUGUGG
				hsa-miR-613	AGGAAUGUUCCUUCUUUGCC
miR-122	4567	4573	m8	hsa-miR-122a	UGGAGUGUGACAAUGGUGUUUGU
miR-128	1712	1718	m8	hsa-miR-128a	UCACAGUGAACCGGUCUCUUUU
miR-128	1712	1718	m8	hsa-miR-128b	UCACAGUGAACCGGUCUCUUUC
miR-133	1456	1462	1A	hsa-miR-133a	UUGGUCCCCUUCAACCAGCUGU
miR-133	1456	1462	1A	hsa-miR-133b	UUGGUCCCCUUCAACCAGCUA
miR-134	1877	1883	m8	hsa-miR-134^brain	UGUGACUGGUUGACCAGAGGG
miR-135	3716	3722	m8	hsa-miR-135a	UAUGGCUUUUUAUUCCUAUGUGA
				hsa-miR-135b	UAUGGCUUUUCAUUCCUAUGUG
				hsa-miR-135a	UAUGGCUUUUUAUUCCUAUGUGA
				hsa-miR-135b	UAUGGCUUUUCAUUCCUAUGUG
miR-138	1725	1731	1A	hsa-miR-138^brain	AGCUGGUGUUGUGAAUC
miR-142-5p	4794	4800	m8	hsa-miR-142-5p	CAUAAAGUAGAAAGCACUAC
miR-148/152	2362	2369	1A,m8	hsa-miR-148a	UCAGUGCACUACAGAACUUUGU
				hsa-miR-152^brain	UCAGUGCAUGACAGAACUUGGG
				hsa-miR-148b	UCAGUGCAUCACAGAACUUUGU
miR-153	433	439	m8	hsa-miR-153	UUGCAUAGUCACAAAAGUGA
miR-181	127	133	1A	hsa-miR-181a^brain	AACAUUCAACGCUGUCGGUGAGU
				hsa-miR-181b^SZ	AACAUUCAUUGCUGUCGGUGGG
				hsa-miR-181c^brain	AACAUUCAACCUGUCGGUGAGU
				hsa-miR-181d^brain	AACAUUCAUUGUUGUCGGUGGGUU
miR-182	1939	1945	m8	hsa-miR-182	UUUGGCAAUGGUAGAACUCACA
miR-185	2661	2668	1A,m8	hsa-miR-185^brain	UGGAGAGAAAGGCAGUUC
miR-205	155	162	1A,m8	hsa-miR-205	UCCUUCAUUCCACCGGAGUCUG
miR-218	4622	4628	m8	hsa-miR-218^brain	UUGUGCUUGAUCUAACCAUGU
miR-221/222	2776	2782	1A	hsa-miR-221^brain	AGCUACAUUGUCUGCUGGGUUUC
miR-221/222	2776	2782	1A	hsa-miR-222^brain	AGCUACAUCUGGCUACUGGGUCUC
miR-23	112	119	1A,m8	hsa-miR-23a^brain	AUCACAUUGCCAGGGAUUUCC
				hsa-miR-23b^brain	AUCACAUUGCCAGGGAUUACC
				hsa-miR-23a^brain	AUCACAUUGCCAGGGAUUUCC
				hsa-miR-23b^brain	AUCACAUUGCCAGGGAUUACC
miR-29	2630	2637	1A,m8	hsa-miR-29a^SZ	UAGCACCAUCUGAAAUCGGUU
				hsa-miR-29b^SZ	UAGCACCAUUUGAAAUCAGUGUU
				hsa-miR-29c^SZ	UAGCACCAUUUGAAAUCGGU
				hsa-miR-29a^SZ	UAGCACCAUCUGAAAUCGGUU
				hsa-miR-29b^SZ	UAGCACCAUUUGAAAUCAGUGUU
				hsa-miR-29c^SZ	UAGCACCAUUUGAAAUCGGU
miR-30-3p	4177	4183	m8	hsa-miR-30a-3p	CUUUCAGUCGGAUGUUUGCAGC
miR-30-3p	4177	4183	m8	hsa-miR-30e-3p	CUUUCAGUCGGAUGUUUACAGC
miR-30-5p	4543	4549	1A	hsa-miR-30a-5p	UGUAAACAUCCUCGACUGGAAG
				hsa-miR-30c^brain	UGUAAACAUCCUACACUCUCAGC
				hsa-miR-30d^SZ	UGUAAACAUCCCCGACUGGAAG
				hsa-miR-30b^SZ	UGUAAACAUCCUACACUCAGCU
				hsa-miR-30e-5p	UGUAAACAUCCUUGACUGGA
miR-320	634	640	1A	hsa-miR-320	AAAAGCUGGGUUGAGAGGGCGAA
miR-323	112	118	1A	hsa-miR-323^brain	GCACAUUACACGGUCGACCUCU
miR-338	2708	2714	m8	hsa-miR-338^brain	UCCAGCAUCAGUGAUUUUGUUGA
miR-34b	3883	3889	1A	hsa-miR-34b	UAGGCAGUGUCAUUAGCUGAUUG
miR-363	2599	2605	1A	hsa-miR-363	AUUGCACGGUAUCCAUCUGUAA
miR-374	4633	4639	1A	hsa-miR-374	UUAUAAUACAACCUGAUAAGUG
miR-375	44	50	1A	hsa-miR-375	UUUGUUCGUUCGGCUCGCGUGA
miR-378*	3400	3406	m8	hsa-miR-422b	CUGGACUUGGAGUCAGAAGGCC
miR-378*	3400	3406	m8	hsa-miR-422a	CUGGACUUAGGGUCAGAAGGCC
miR-380-5p	1420	1426	1A	hsa-miR-380-5p	UGGUUGACCAUAGAACAUGCGC
miR-380-5p	1420	1426	1A	hsa-miR-563	AGGUUGACAUACGUUUCCC
miR-410	2385	2391	1A	hsa-miR-410	AAUAUAACACAGAUGGCCUGU
miR-452	2642	2648	m8	hsa-miR-452	UGUUUGCAGAGGAAACUGAGAC
miR-493-5p	129	136	1A,m8	hsa-miR-493-5p	UUGUACAUGGUAGGCUUUCAUU
miR-500	2598	2604	1A	hsa-miR-500	AUGCACCUGGGCAAGGAUUCUG

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: DLG2