Gene Page: DMPK
Summary ?
GeneID | 1760 |
Symbol | DMPK |
Synonyms | DM|DM1|DM1PK|DMK|MDPK|MT-PK |
Description | dystrophia myotonica protein kinase |
Reference | MIM:605377|HGNC:HGNC:2933|Ensembl:ENSG00000104936|HPRD:05645|Vega:OTTHUMG00000182334 |
Gene type | protein-coding |
Map location | 19q13.3 |
Pascal p-value | 0.14 |
Sherlock p-value | 0.702 |
Fetal beta | -0.044 |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0000166 | nucleotide binding | IEA | - | |
GO:0000287 | magnesium ion binding | IEA | - | |
GO:0005524 | ATP binding | IDA | 10913253 | |
GO:0005524 | ATP binding | IEA | - | |
GO:0004674 | protein serine/threonine kinase activity | IDA | 10913253 | |
GO:0004674 | protein serine/threonine kinase activity | IEA | - | |
GO:0016740 | transferase activity | IEA | - | |
GO:0042802 | identical protein binding | IPI | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0006464 | protein modification process | TAS | 1310900 | |
GO:0006468 | protein amino acid phosphorylation | IDA | 10913253 | |
GO:0006468 | protein amino acid phosphorylation | IEA | - | |
GO:0008016 | regulation of heart contraction | IDA | 15598648 | |
GO:0051056 | regulation of small GTPase mediated signal transduction | IPI | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005737 | cytoplasm | IDA | 18029348 | |
GO:0043231 | intracellular membrane-bounded organelle | IDA | 18029348 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
GARY CD5 TARGETS UP | 473 | 314 | All SZGR 2.0 genes in this pathway |
RODRIGUES NTN1 TARGETS DN | 158 | 102 | All SZGR 2.0 genes in this pathway |
CHEBOTAEV GR TARGETS DN | 120 | 73 | All SZGR 2.0 genes in this pathway |
GRAESSMANN APOPTOSIS BY DOXORUBICIN UP | 1142 | 669 | All SZGR 2.0 genes in this pathway |
GRAESSMANN RESPONSE TO MC AND DOXORUBICIN UP | 612 | 367 | All SZGR 2.0 genes in this pathway |
MCBRYAN PUBERTAL BREAST 4 5WK DN | 196 | 131 | All SZGR 2.0 genes in this pathway |
EBAUER TARGETS OF PAX3 FOXO1 FUSION UP | 207 | 128 | All SZGR 2.0 genes in this pathway |
DACOSTA UV RESPONSE VIA ERCC3 UP | 309 | 199 | All SZGR 2.0 genes in this pathway |
GRUETZMANN PANCREATIC CANCER DN | 203 | 134 | All SZGR 2.0 genes in this pathway |
LEE LIVER CANCER MYC UP | 54 | 30 | All SZGR 2.0 genes in this pathway |
KANNAN TP53 TARGETS UP | 58 | 40 | All SZGR 2.0 genes in this pathway |
FERRANDO T ALL WITH MLL ENL FUSION UP | 87 | 67 | All SZGR 2.0 genes in this pathway |
AFFAR YY1 TARGETS UP | 214 | 133 | All SZGR 2.0 genes in this pathway |
KUMAR TARGETS OF MLL AF9 FUSION | 405 | 264 | All SZGR 2.0 genes in this pathway |
REN ALVEOLAR RHABDOMYOSARCOMA UP | 98 | 64 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE UP | 1691 | 1088 | All SZGR 2.0 genes in this pathway |
DELASERNA MYOD TARGETS UP | 89 | 51 | All SZGR 2.0 genes in this pathway |
MARSON BOUND BY FOXP3 UNSTIMULATED | 1229 | 713 | All SZGR 2.0 genes in this pathway |
FIRESTEIN PROLIFERATION | 175 | 125 | All SZGR 2.0 genes in this pathway |
LINDSTEDT DENDRITIC CELL MATURATION D | 68 | 44 | All SZGR 2.0 genes in this pathway |
AGUIRRE PANCREATIC CANCER COPY NUMBER UP | 298 | 174 | All SZGR 2.0 genes in this pathway |
MIKKELSEN MEF LCP WITH H3K4ME3 | 128 | 68 | All SZGR 2.0 genes in this pathway |
YAO TEMPORAL RESPONSE TO PROGESTERONE CLUSTER 16 | 79 | 47 | All SZGR 2.0 genes in this pathway |
PILON KLF1 TARGETS UP | 504 | 321 | All SZGR 2.0 genes in this pathway |
JOHNSTONE PARVB TARGETS 2 UP | 140 | 94 | All SZGR 2.0 genes in this pathway |
BAKKER FOXO3 TARGETS DN | 187 | 109 | All SZGR 2.0 genes in this pathway |
LEE BMP2 TARGETS UP | 745 | 475 | All SZGR 2.0 genes in this pathway |
KATSANOU ELAVL1 TARGETS UP | 169 | 105 | All SZGR 2.0 genes in this pathway |
DELACROIX RARG BOUND MEF | 367 | 231 | All SZGR 2.0 genes in this pathway |
KUMAR PATHOGEN LOAD BY MACROPHAGES | 275 | 155 | All SZGR 2.0 genes in this pathway |
ACEVEDO FGFR1 TARGETS IN PROSTATE CANCER MODEL DN | 308 | 187 | All SZGR 2.0 genes in this pathway |
DURAND STROMA NS UP | 162 | 103 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-1/206 | 681 | 687 | m8 | hsa-miR-1 | UGGAAUGUAAAGAAGUAUGUA |
hsa-miR-206SZ | UGGAAUGUAAGGAAGUGUGUGG | ||||
hsa-miR-613 | AGGAAUGUUCCUUCUUUGCC | ||||
miR-491 | 705 | 711 | m8 | hsa-miR-491brain | AGUGGGGAACCCUUCCAUGAGGA |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.