SZGR2

Summary ?

GeneID	1859
Symbol	DYRK1A
Synonyms	DYRK\|DYRK1\|HP86\|MNB\|MNBH\|MRD7
Description	dual specificity tyrosine phosphorylation regulated kinase 1A
Reference	MIM:600855\|HGNC:HGNC:3091\|Ensembl:ENSG00000157540\|HPRD:09018\|Vega:OTTHUMG00000086657
Gene type	protein-coding
Map location	21q22.13
Pascal p-value	0.049
Sherlock p-value	0.001
Fetal beta	0.656

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 1

Section I. Genetics and epigenetics annotation

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
ANAPC1	0.83	0.87
TUBGCP4	0.83	0.86
ANKRD28	0.82	0.87
CEP68	0.82	0.87
ADAR	0.82	0.87
MYH10	0.82	0.84
SMG7	0.82	0.87
LIN54	0.82	0.85
VPS13B	0.82	0.84
KIAA0947	0.82	0.87

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
FXYD1	-0.66	-0.70
HIGD1B	-0.65	-0.72
MT-CO2	-0.64	-0.70
AF347015.31	-0.64	-0.68
AF347015.21	-0.63	-0.73
TLCD1	-0.62	-0.66
AC021016.1	-0.62	-0.65
AF347015.33	-0.61	-0.64
IFI27	-0.61	-0.67
CST3	-0.61	-0.67

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0000166	nucleotide binding	IEA		-
GO:0005524	ATP binding	IEA		-
GO:0004674	protein serine/threonine kinase activity	ISS		-
GO:0004715	non-membrane spanning protein tyrosine kinase activity	IDA		9748265
GO:0016740	transferase activity	IEA		-
GO:0016301	kinase activity	IEA		-
GO:0043621	protein self-association	IEA		-
GO:0043621	protein self-association	ISS		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0007399	nervous system development	TAS	neurite (GO term level: 5)	8769099
GO:0018108	peptidyl-tyrosine phosphorylation	ISS		-
GO:0046777	protein amino acid autophosphorylation	ISS		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005634	nucleus	ISS		-
GO:0016607	nuclear speck	ISS		-

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
CCNL2	ANIA-6B \| CCNM \| DKFZp761A1210 \| DKFZp762O195 \| HCLA-ISO \| HLA-ISO \| PCEE \| SB138	cyclin L2	-	HPRD,BioGRID	14623875
CREB1	CREB \| MGC9284	cAMP responsive element binding protein 1	DYRK1A interacts with and phosphorylates CREB. This interaction was modeled on a demonstrated interaction between human DYRK1A and CREB from rat.	BIND	15694837
DNM1	DNM	dynamin 1	Reconstituted Complex	BioGRID	11877424
PHYHIP	DYRK1AP3 \| KIAA0273 \| PAHX-AP \| PAHXAP1	phytanoyl-CoA 2-hydroxylase interacting protein	DYRK1A interacts with PAHX-AP1.	BIND	15694837
PHYHIP	DYRK1AP3 \| KIAA0273 \| PAHX-AP \| PAHXAP1	phytanoyl-CoA 2-hydroxylase interacting protein	-	HPRD	15694837
SFN	YWHAS	stratifin	Affinity Capture-MS	BioGRID	15778465
SFRS1	ASF \| MGC5228 \| SF2 \| SF2p33 \| SRp30a	splicing factor, arginine/serine-rich 1	Biochemical Activity	BioGRID	14623875
SFRS16	CLASP \| FLJ90109 \| SWAP2	splicing factor, arginine/serine-rich 16	Biochemical Activity	BioGRID	14623875
SFRS4	SRP75	splicing factor, arginine/serine-rich 4	Biochemical Activity	BioGRID	14623875
SFRS5	HRS \| SRP40	splicing factor, arginine/serine-rich 5	Biochemical Activity	BioGRID	14623875
WDR68	AN11 \| HAN11	WD repeat domain 68	Affinity Capture-Western Co-purification	BioGRID	14593110
YWHAG	14-3-3GAMMA	tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, gamma polypeptide	-	HPRD	15324660

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
BIOCARTA SHH PATHWAY	16	15	All SZGR 2.0 genes in this pathway
REACTOME G0 AND EARLY G1	25	13	All SZGR 2.0 genes in this pathway
REACTOME CELL CYCLE	421	253	All SZGR 2.0 genes in this pathway
REACTOME CELL CYCLE MITOTIC	325	185	All SZGR 2.0 genes in this pathway
REACTOME MITOTIC G1 G1 S PHASES	137	79	All SZGR 2.0 genes in this pathway
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP	1382	904	All SZGR 2.0 genes in this pathway
WANG LMO4 TARGETS UP	372	227	All SZGR 2.0 genes in this pathway
TAKEDA TARGETS OF NUP98 HOXA9 FUSION 6HR DN	41	29	All SZGR 2.0 genes in this pathway
UDAYAKUMAR MED1 TARGETS DN	240	171	All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN	1781	1082	All SZGR 2.0 genes in this pathway
DARWICHE PAPILLOMA PROGRESSION RISK	74	44	All SZGR 2.0 genes in this pathway
SCHLOSSER SERUM RESPONSE DN	712	443	All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 DN	855	609	All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 COMMON DN	483	336	All SZGR 2.0 genes in this pathway
AMUNDSON RESPONSE TO ARSENITE	217	143	All SZGR 2.0 genes in this pathway
GEORGES TARGETS OF MIR192 AND MIR215	893	528	All SZGR 2.0 genes in this pathway
SMITH TERT TARGETS UP	145	91	All SZGR 2.0 genes in this pathway
PENG LEUCINE DEPRIVATION DN	187	122	All SZGR 2.0 genes in this pathway
CHEOK RESPONSE TO HD MTX DN	24	18	All SZGR 2.0 genes in this pathway
PENG GLUCOSE DEPRIVATION DN	169	112	All SZGR 2.0 genes in this pathway
PENG GLUTAMINE DEPRIVATION DN	337	230	All SZGR 2.0 genes in this pathway
FLECHNER BIOPSY KIDNEY TRANSPLANT OK VS DONOR UP	555	346	All SZGR 2.0 genes in this pathway
CROMER METASTASIS UP	79	46	All SZGR 2.0 genes in this pathway
DEBIASI APOPTOSIS BY REOVIRUS INFECTION UP	314	201	All SZGR 2.0 genes in this pathway
DAZARD RESPONSE TO UV SCC DN	123	86	All SZGR 2.0 genes in this pathway
GENTILE UV RESPONSE CLUSTER D5	39	26	All SZGR 2.0 genes in this pathway
GENTILE UV HIGH DOSE DN	312	203	All SZGR 2.0 genes in this pathway
DAZARD RESPONSE TO UV NHEK DN	318	220	All SZGR 2.0 genes in this pathway
BAELDE DIABETIC NEPHROPATHY DN	434	302	All SZGR 2.0 genes in this pathway
LEE CALORIE RESTRICTION MUSCLE DN	51	28	All SZGR 2.0 genes in this pathway
MARSON BOUND BY FOXP3 STIMULATED	1022	619	All SZGR 2.0 genes in this pathway
FINETTI BREAST CANCERS KINOME GRAY	15	10	All SZGR 2.0 genes in this pathway
IWANAGA CARCINOGENESIS BY KRAS PTEN DN	353	226	All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS UP	1305	895	All SZGR 2.0 genes in this pathway
ZHAN VARIABLE EARLY DIFFERENTIATION GENES DN	30	19	All SZGR 2.0 genes in this pathway
YAGI AML WITH INV 16 TRANSLOCATION	422	277	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 4HR DN	254	158	All SZGR 2.0 genes in this pathway
WIERENGA STAT5A TARGETS DN	213	127	All SZGR 2.0 genes in this pathway
BRUINS UVC RESPONSE LATE	1137	655	All SZGR 2.0 genes in this pathway
PURBEY TARGETS OF CTBP1 NOT SATB1 DN	448	282	All SZGR 2.0 genes in this pathway
WAKABAYASHI ADIPOGENESIS PPARG BOUND 8D	658	397	All SZGR 2.0 genes in this pathway
LOPEZ TRANSLATION VIA FN1 SIGNALING	35	21	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
let-7/98	1905	1911	m8	hsa-let-7a^brain	UGAGGUAGUAGGUUGUAUAGUU
				hsa-let-7b^brain	UGAGGUAGUAGGUUGUGUGGUU
				hsa-let-7c^brain	UGAGGUAGUAGGUUGUAUGGUU
				hsa-let-7d^brain	AGAGGUAGUAGGUUGCAUAGU
				hsa-let-7e^brain	UGAGGUAGGAGGUUGUAUAGU
				hsa-let-7f^brain	UGAGGUAGUAGAUUGUAUAGUU
				hsa-miR-98^brain	UGAGGUAGUAAGUUGUAUUGUU
				hsa-let-7g^SZ	UGAGGUAGUAGUUUGUACAGU
				hsa-let-7i^brain	UGAGGUAGUAGUUUGUGCUGU
miR-101	520	527	1A,m8	hsa-miR-101	UACAGUACUGUGAUAACUGAAG
miR-129-5p	2347	2353	1A	hsa-miR-129^brain	CUUUUUGCGGUCUGGGCUUGC
miR-129-5p	2347	2353	1A	hsa-miR-129-5p	CUUUUUGCGGUCUGGGCUUGCU
miR-137	763	769	m8	hsa-miR-137	UAUUGCUUAAGAAUACGCGUAG
miR-144	521	527	1A	hsa-miR-144	UACAGUAUAGAUGAUGUACUAG
miR-145	1421	1428	1A,m8	hsa-miR-145	GUCCAGUUUUCCCAGGAAUCCCUU
miR-148/152	754	761	1A,m8	hsa-miR-148a	UCAGUGCACUACAGAACUUUGU
				hsa-miR-152^brain	UCAGUGCAUGACAGAACUUGGG
				hsa-miR-148b	UCAGUGCAUCACAGAACUUUGU
miR-150	1838	1845	1A,m8	hsa-miR-150	UCUCCCAACCCUUGUACCAGUG
miR-17-5p/20/93.mr/106/519.d	1345	1351	m8	hsa-miR-17-5p	CAAAGUGCUUACAGUGCAGGUAGU
				hsa-miR-20a^brain	UAAAGUGCUUAUAGUGCAGGUAG
				hsa-miR-106a	AAAAGUGCUUACAGUGCAGGUAGC
				hsa-miR-106b^SZ	UAAAGUGCUGACAGUGCAGAU
				hsa-miR-20b^SZ	CAAAGUGCUCAUAGUGCAGGUAG
				hsa-miR-519d	CAAAGUGCCUCCCUUUAGAGUGU
miR-182	330	336	m8	hsa-miR-182	UUUGGCAAUGGUAGAACUCACA
miR-192/215	1985	1992	1A,m8	hsa-miR-192	CUGACCUAUGAAUUGACAGCC
miR-192/215	1985	1992	1A,m8	hsa-miR-215	AUGACCUAUGAAUUGACAGAC
miR-193	785	791	m8	hsa-miR-193a	AACUGGCCUACAAAGUCCCAG
miR-193	785	791	m8	hsa-miR-193b	AACUGGCCCUCAAAGUCCCGCUUU
miR-203.1	869	875	1A	hsa-miR-203	UGAAAUGUUUAGGACCACUAG
miR-204/211	159	165	m8	hsa-miR-204^brain	UUCCCUUUGUCAUCCUAUGCCU
miR-204/211	159	165	m8	hsa-miR-211	UUCCCUUUGUCAUCCUUCGCCU
miR-216	93	99	1A	hsa-miR-216	UAAUCUCAGCUGGCAACUGUG
miR-217	515	522	1A,m8	hsa-miR-217	UACUGCAUCAGGAACUGAUUGGAU
miR-26	144	150	1A	hsa-miR-26a^brain	UUCAAGUAAUCCAGGAUAGGC
				hsa-miR-26b^SZ	UUCAAGUAAUUCAGGAUAGGUU
				hsa-miR-26a^brain	UUCAAGUAAUCCAGGAUAGGC
				hsa-miR-26b^SZ	UUCAAGUAAUUCAGGAUAGGUU
miR-27	1244	1250	1A	hsa-miR-27a^brain	UUCACAGUGGCUAAGUUCCGC
miR-27	1244	1250	1A	hsa-miR-27b^brain	UUCACAGUGGCUAAGUUCUGC
miR-30-3p	920	926	1A	hsa-miR-30a-3p	CUUUCAGUCGGAUGUUUGCAGC
miR-30-3p	920	926	1A	hsa-miR-30e-3p	CUUUCAGUCGGAUGUUUACAGC
miR-330	1067	1074	1A,m8	hsa-miR-330^brain	GCAAAGCACACGGCCUGCAGAGA
miR-346	903	909	1A	hsa-miR-346^brain	UGUCUGCCCGCAUGCCUGCCUCU
miR-363	69	75	1A	hsa-miR-363	AUUGCACGGUAUCCAUCUGUAA
miR-378	2122	2128	1A	hsa-miR-378	CUCCUGACUCCAGGUCCUGUGU
miR-409-5p	1322	1328	1A	hsa-miR-409-5p	AGGUUACCCGAGCAACUUUGCA
miR-455	1308	1314	1A	hsa-miR-455	UAUGUGCCUUUGGACUACAUCG
miR-455	1308	1314	1A	hsa-miR-455	UAUGUGCCUUUGGACUACAUCG
miR-485-3p	2616	2622	m8	hsa-miR-485-3p	GUCAUACACGGCUCUCCUCUCU
miR-486	2466	2472	1A	hsa-miR-486	UCCUGUACUGAGCUGCCCCGAG
miR-495	17	23	m8	hsa-miR-495^brain	AAACAAACAUGGUGCACUUCUUU
miR-496	2688	2694	1A	hsa-miR-496	AUUACAUGGCCAAUCUC
miR-544	1203	1209	m8	hsa-miR-544	AUUCUGCAUUUUUAGCAAGU
miR-9	1290	1296	m8	hsa-miR-9^SZ	UCUUUGGUUAUCUAGCUGUAUGA

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: DYRK1A