Gene Page: E2F3
Summary ?
GeneID | 1871 |
Symbol | E2F3 |
Synonyms | E2F-3 |
Description | E2F transcription factor 3 |
Reference | MIM:600427|HGNC:HGNC:3115|Ensembl:ENSG00000112242|HPRD:02693|Vega:OTTHUMG00000016389 |
Gene type | protein-coding |
Map location | 6p22 |
Pascal p-value | 0.069 |
Sherlock p-value | 0.527 |
Fetal beta | 0.309 |
DMG | 1 (# studies) |
eGene | Myers' cis & trans |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Jaffe_2016 | Genome-wide DNA methylation analysis | This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. | 1 |
GSMA_I | Genome scan meta-analysis | Psr: 0.033 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg09133386 | 6 | 20404188 | E2F3 | 7.39E-10 | -0.018 | 9.98E-7 | DMG:Jaffe_2016 |
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs7270082 | chr20 | 17036184 | E2F3 | 1871 | 0.18 | trans | ||
rs7274416 | chr20 | 17040352 | E2F3 | 1871 | 0.07 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0003700 | transcription factor activity | IEA | - | |
GO:0003700 | transcription factor activity | TAS | 8246996 | |
GO:0005515 | protein binding | IPI | 17438371 | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0006355 | regulation of transcription, DNA-dependent | IEA | - | |
GO:0006367 | transcription initiation from RNA polymerase II promoter | TAS | 8246996 | |
GO:0006350 | transcription | IEA | - | |
GO:0007049 | cell cycle | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005634 | nucleus | IEA | - | |
GO:0005654 | nucleoplasm | EXP | 9190208 | |
GO:0005667 | transcription factor complex | IEA | - |
Section IV. Protein-protein interaction annotation
Interactors | Aliases B | Official full name B | Experimental | Source | PubMed ID |
---|---|---|---|---|---|
BIRC5 | API4 | EPR-1 | baculoviral IAP repeat-containing 5 | E2F3 (E2F-3) interacts with the BIRC5 (survivin) promoter. | BIND | 15271987 |
CDC2 | CDC28A | CDK1 | DKFZp686L20222 | MGC111195 | cell division cycle 2, G1 to S and G2 to M | E2F3 interacts with the Cdc2 promoter. | BIND | 10766737 |
CDC25A | CDC25A2 | cell division cycle 25 homolog A (S. pombe) | E2F3 interacts with the Cdc25A promoter. | BIND | 10766737 |
CDC6 | CDC18L | HsCDC18 | HsCDC6 | cell division cycle 6 homolog (S. cerevisiae) | E2F3 interacts with the Cdc6 promoter. | BIND | 10766737 |
CDK3 | - | cyclin-dependent kinase 3 | - | HPRD,BioGRID | 8846921 |11733001 |
CREBBP | CBP | KAT3A | RSTS | CREB binding protein | Two-hybrid | BioGRID | 12748276 |
EAPP | BM036 | C14orf11 | FLJ20578 | MGC4957 | E2F-associated phosphoprotein | E2F3 interacts with EAPP. | BIND | 15716352 |
FHL2 | AAG11 | DRAL | SLIM3 | four and a half LIM domains 2 | Two-hybrid | BioGRID | 12411495 |
FHL2 | AAG11 | DRAL | SLIM3 | four and a half LIM domains 2 | E2F3 interacts with a molecule expressed by Gene FHL2. The precise molecular variant of FHL2 involved in this interaction is not specified. | BIND | 12411495 |
GAB2 | KIAA0571 | GRB2-associated binding protein 2 | The Gab2 promoter region interacts with E2F3. | BIND | 15574337 |
JMY | FLJ37870 | MGC163496 | junction-mediating and regulatory protein | E2F3 interacts with the JMY promoter. | BIND | 15706352 |
MGA | FLJ12634 | KIAA0518 | MAD5 | MXD5 | MAX gene associated | Two-hybrid | BioGRID | 12748276 |
MSH2 | COCA1 | FCC1 | HNPCC | HNPCC1 | LCFS2 | mutS homolog 2, colon cancer, nonpolyposis type 1 (E. coli) | E2F3 interacts with the MSH2 promoter. | BIND | 11799067 |
MT1G | MGC12386 | MT1 | MT1K | metallothionein 1G | E2F3 interacts with the MT1G promoter. | BIND | 15735762 |
MYBL2 | B-MYB | BMYB | MGC15600 | v-myb myeloblastosis viral oncogene homolog (avian)-like 2 | E2F3 interacts with the B-myb promoter region. | BIND | 10766737 |
MYBL2 | B-MYB | BMYB | MGC15600 | v-myb myeloblastosis viral oncogene homolog (avian)-like 2 | Two-hybrid | BioGRID | 12748276 |
PKIB | FLJ23817 | PRKACN2 | protein kinase (cAMP-dependent, catalytic) inhibitor beta | Two-hybrid | BioGRID | 12748276 |
PPP1R13B | ASPP1 | KIAA0771 | p53BP2-like | p85 | protein phosphatase 1, regulatory (inhibitor) subunit 13B | E2F3 interacts with the PPP1R13B (ASPP1) promoter. | BIND | 15706352 |
RNF144A | KIAA0161 | RNF144 | UBCE7IP4 | ring finger protein 144A | Two-hybrid | BioGRID | 12411495 |
RYBP | AAP1 | DEDAF | YEAF1 | RING1 and YY1 binding protein | Affinity Capture-Western Two-hybrid | BioGRID | 12411495 |
RYBP | AAP1 | DEDAF | YEAF1 | RING1 and YY1 binding protein | E2F3 interacts with RYBP. | BIND | 12411495 |
SP1 | - | Sp1 transcription factor | - | HPRD | 8657141 |
SPIB | SPI-B | Spi-B transcription factor (Spi-1/PU.1 related) | Two-hybrid | BioGRID | 12748276 |
TEAD3 | DTEF-1 | ETFR-1 | TEAD5 | TEF-5 | TEF5 | TEA domain family member 3 | Two-hybrid | BioGRID | 12748276 |
TFDP1 | DP1 | DRTF1 | Dp-1 | transcription factor Dp-1 | - | HPRD | 7739537 |8755520 |
TFDP2 | DP2 | Dp-2 | transcription factor Dp-2 (E2F dimerization partner 2) | - | HPRD | 7739537 |8755520 |
TFE3 | RCCP2 | TFEA | bHLHe33 | transcription factor binding to IGHM enhancer 3 | - | HPRD,BioGRID | 12748276 |
TP53BP2 | 53BP2 | ASPP2 | BBP | PPP1R13A | p53BP2 | tumor protein p53 binding protein, 2 | E2F3 interacts with the TP53BP2 (ASPP2) promoter. | BIND | 15706352 |
TP53INP1 | DKFZp434M1317 | FLJ22139 | SIP | TP53DINP1 | TP53INP1A | TP53INP1B | Teap | p53DINP1 | tumor protein p53 inducible nuclear protein 1 | E2F3 interacts with the TP53INP1 promoter. | BIND | 15706352 |
UXT | ART-27 | ubiquitously-expressed transcript | E2F3 interacts with the UXT chromatin. | BIND | 11799066 |
WNK1 | KDP | KIAA0344 | PHA2C | PRKWNK1 | PSK | WNK lysine deficient protein kinase 1 | Two-hybrid | BioGRID | 12748276 |
YY1 | DELTA | INO80S | NF-E1 | UCRBP | YIN-YANG-1 | YY1 transcription factor | - | HPRD | 12411495 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG CELL CYCLE | 128 | 84 | All SZGR 2.0 genes in this pathway |
KEGG PATHWAYS IN CANCER | 328 | 259 | All SZGR 2.0 genes in this pathway |
KEGG PANCREATIC CANCER | 70 | 56 | All SZGR 2.0 genes in this pathway |
KEGG GLIOMA | 65 | 56 | All SZGR 2.0 genes in this pathway |
KEGG PROSTATE CANCER | 89 | 75 | All SZGR 2.0 genes in this pathway |
KEGG MELANOMA | 71 | 57 | All SZGR 2.0 genes in this pathway |
KEGG BLADDER CANCER | 42 | 33 | All SZGR 2.0 genes in this pathway |
KEGG CHRONIC MYELOID LEUKEMIA | 73 | 59 | All SZGR 2.0 genes in this pathway |
KEGG SMALL CELL LUNG CANCER | 84 | 67 | All SZGR 2.0 genes in this pathway |
KEGG NON SMALL CELL LUNG CANCER | 54 | 47 | All SZGR 2.0 genes in this pathway |
PID E2F PATHWAY | 74 | 48 | All SZGR 2.0 genes in this pathway |
PID MYC ACTIV PATHWAY | 79 | 62 | All SZGR 2.0 genes in this pathway |
PID P53 DOWNSTREAM PATHWAY | 137 | 94 | All SZGR 2.0 genes in this pathway |
PID RB 1PATHWAY | 65 | 46 | All SZGR 2.0 genes in this pathway |
REACTOME CELL CYCLE | 421 | 253 | All SZGR 2.0 genes in this pathway |
REACTOME PRE NOTCH TRANSCRIPTION AND TRANSLATION | 29 | 17 | All SZGR 2.0 genes in this pathway |
REACTOME PRE NOTCH EXPRESSION AND PROCESSING | 44 | 24 | All SZGR 2.0 genes in this pathway |
REACTOME CELL CYCLE MITOTIC | 325 | 185 | All SZGR 2.0 genes in this pathway |
REACTOME G1 PHASE | 38 | 23 | All SZGR 2.0 genes in this pathway |
REACTOME CDC6 ASSOCIATION WITH THE ORC ORIGIN COMPLEX | 11 | 5 | All SZGR 2.0 genes in this pathway |
REACTOME M G1 TRANSITION | 81 | 45 | All SZGR 2.0 genes in this pathway |
REACTOME MITOTIC G1 G1 S PHASES | 137 | 79 | All SZGR 2.0 genes in this pathway |
REACTOME MITOTIC M M G1 PHASES | 172 | 98 | All SZGR 2.0 genes in this pathway |
REACTOME MITOTIC G2 G2 M PHASES | 81 | 50 | All SZGR 2.0 genes in this pathway |
REACTOME ASSEMBLY OF THE PRE REPLICATIVE COMPLEX | 65 | 36 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALING BY NOTCH | 103 | 64 | All SZGR 2.0 genes in this pathway |
REACTOME DNA REPLICATION | 192 | 110 | All SZGR 2.0 genes in this pathway |
LIU SOX4 TARGETS UP | 137 | 94 | All SZGR 2.0 genes in this pathway |
SENGUPTA NASOPHARYNGEAL CARCINOMA UP | 294 | 178 | All SZGR 2.0 genes in this pathway |
WANG LMO4 TARGETS UP | 372 | 227 | All SZGR 2.0 genes in this pathway |
DODD NASOPHARYNGEAL CARCINOMA DN | 1375 | 806 | All SZGR 2.0 genes in this pathway |
NUNODA RESPONSE TO DASATINIB IMATINIB UP | 29 | 20 | All SZGR 2.0 genes in this pathway |
OLSSON E2F3 TARGETS DN | 49 | 33 | All SZGR 2.0 genes in this pathway |
KONG E2F3 TARGETS | 97 | 58 | All SZGR 2.0 genes in this pathway |
FARMER BREAST CANCER APOCRINE VS BASAL | 330 | 217 | All SZGR 2.0 genes in this pathway |
FARMER BREAST CANCER BASAL VS LULMINAL | 330 | 215 | All SZGR 2.0 genes in this pathway |
GRASEMANN RETINOBLASTOMA WITH 6P AMPLIFICATION | 14 | 14 | All SZGR 2.0 genes in this pathway |
PATIL LIVER CANCER | 747 | 453 | All SZGR 2.0 genes in this pathway |
DACOSTA UV RESPONSE VIA ERCC3 DN | 855 | 609 | All SZGR 2.0 genes in this pathway |
DACOSTA UV RESPONSE VIA ERCC3 COMMON DN | 483 | 336 | All SZGR 2.0 genes in this pathway |
OXFORD RALA OR RALB TARGETS UP | 48 | 23 | All SZGR 2.0 genes in this pathway |
SHETH LIVER CANCER VS TXNIP LOSS PAM1 | 229 | 137 | All SZGR 2.0 genes in this pathway |
PUJANA BRCA1 PCC NETWORK | 1652 | 1023 | All SZGR 2.0 genes in this pathway |
WEI MYCN TARGETS WITH E BOX | 795 | 478 | All SZGR 2.0 genes in this pathway |
RICKMAN TUMOR DIFFERENTIATED MODERATELY VS POORLY UP | 121 | 71 | All SZGR 2.0 genes in this pathway |
COURTOIS SENESCENCE TRIGGERS | 6 | 5 | All SZGR 2.0 genes in this pathway |
BENPORATH NANOG TARGETS | 988 | 594 | All SZGR 2.0 genes in this pathway |
BENPORATH SOX2 TARGETS | 734 | 436 | All SZGR 2.0 genes in this pathway |
BENPORATH ES CORE NINE CORRELATED | 100 | 68 | All SZGR 2.0 genes in this pathway |
GOTTWEIN TARGETS OF KSHV MIR K12 11 | 63 | 45 | All SZGR 2.0 genes in this pathway |
DING LUNG CANCER EXPRESSION BY COPY NUMBER | 100 | 62 | All SZGR 2.0 genes in this pathway |
REN BOUND BY E2F | 61 | 40 | All SZGR 2.0 genes in this pathway |
FLECHNER BIOPSY KIDNEY TRANSPLANT OK VS DONOR UP | 555 | 346 | All SZGR 2.0 genes in this pathway |
DAZARD RESPONSE TO UV SCC DN | 123 | 86 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 18HR UP | 178 | 111 | All SZGR 2.0 genes in this pathway |
GENTILE UV HIGH DOSE DN | 312 | 203 | All SZGR 2.0 genes in this pathway |
HEDENFALK BREAST CANCER BRCA1 VS BRCA2 | 163 | 113 | All SZGR 2.0 genes in this pathway |
GENTILE UV RESPONSE CLUSTER D1 | 18 | 13 | All SZGR 2.0 genes in this pathway |
DAZARD RESPONSE TO UV NHEK DN | 318 | 220 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 24HR UP | 148 | 96 | All SZGR 2.0 genes in this pathway |
DOUGLAS BMI1 TARGETS UP | 566 | 371 | All SZGR 2.0 genes in this pathway |
SMID BREAST CANCER BASAL UP | 648 | 398 | All SZGR 2.0 genes in this pathway |
BONCI TARGETS OF MIR15A AND MIR16 1 | 91 | 75 | All SZGR 2.0 genes in this pathway |
LU TUMOR ANGIOGENESIS UP | 25 | 22 | All SZGR 2.0 genes in this pathway |
WOO LIVER CANCER RECURRENCE UP | 105 | 75 | All SZGR 2.0 genes in this pathway |
DANG MYC TARGETS UP | 143 | 100 | All SZGR 2.0 genes in this pathway |
DANG BOUND BY MYC | 1103 | 714 | All SZGR 2.0 genes in this pathway |
WONG EMBRYONIC STEM CELL CORE | 335 | 193 | All SZGR 2.0 genes in this pathway |
CHANDRAN METASTASIS UP | 221 | 135 | All SZGR 2.0 genes in this pathway |
VERHAAK GLIOBLASTOMA PRONEURAL | 177 | 132 | All SZGR 2.0 genes in this pathway |
JOHNSTONE PARVB TARGETS 2 DN | 336 | 211 | All SZGR 2.0 genes in this pathway |
BRUINS UVC RESPONSE EARLY LATE | 317 | 190 | All SZGR 2.0 genes in this pathway |
LEE BMP2 TARGETS DN | 882 | 538 | All SZGR 2.0 genes in this pathway |
DUAN PRDM5 TARGETS | 79 | 52 | All SZGR 2.0 genes in this pathway |
RAFFEL VEGFA TARGETS UP | 9 | 8 | All SZGR 2.0 genes in this pathway |
KUMAR PATHOGEN LOAD BY MACROPHAGES | 275 | 155 | All SZGR 2.0 genes in this pathway |
ZWANG TRANSIENTLY UP BY 1ST EGF PULSE ONLY | 1839 | 928 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-10 | 3180 | 3186 | m8 | hsa-miR-10a | UACCCUGUAGAUCCGAAUUUGUG |
hsa-miR-10b | UACCCUGUAGAACCGAAUUUGU | ||||
miR-124/506 | 418 | 424 | m8 | hsa-miR-506 | UAAGGCACCCUUCUGAGUAGA |
hsa-miR-124brain | UAAGGCACGCGGUGAAUGCC | ||||
miR-125/351 | 1185 | 1192 | 1A,m8 | hsa-miR-125bbrain | UCCCUGAGACCCUAACUUGUGA |
hsa-miR-125abrain | UCCCUGAGACCCUUUAACCUGUG | ||||
miR-128 | 2039 | 2045 | m8 | hsa-miR-128a | UCACAGUGAACCGGUCUCUUUU |
hsa-miR-128b | UCACAGUGAACCGGUCUCUUUC | ||||
miR-140 | 1740 | 1747 | 1A,m8 | hsa-miR-140brain | AGUGGUUUUACCCUAUGGUAG |
miR-141/200a | 2603 | 2610 | 1A,m8 | hsa-miR-141 | UAACACUGUCUGGUAAAGAUGG |
hsa-miR-200a | UAACACUGUCUGGUAACGAUGU | ||||
hsa-miR-141 | UAACACUGUCUGGUAAAGAUGG | ||||
hsa-miR-200a | UAACACUGUCUGGUAACGAUGU | ||||
miR-145 | 2029 | 2035 | 1A | hsa-miR-145 | GUCCAGUUUUCCCAGGAAUCCCUU |
miR-148/152 | 2037 | 2043 | m8 | hsa-miR-148a | UCAGUGCACUACAGAACUUUGU |
hsa-miR-152brain | UCAGUGCAUGACAGAACUUGGG | ||||
hsa-miR-148b | UCAGUGCAUCACAGAACUUUGU | ||||
miR-15/16/195/424/497 | 2491 | 2498 | 1A,m8 | hsa-miR-15abrain | UAGCAGCACAUAAUGGUUUGUG |
hsa-miR-16brain | UAGCAGCACGUAAAUAUUGGCG | ||||
hsa-miR-15bbrain | UAGCAGCACAUCAUGGUUUACA | ||||
hsa-miR-195SZ | UAGCAGCACAGAAAUAUUGGC | ||||
hsa-miR-424 | CAGCAGCAAUUCAUGUUUUGAA | ||||
hsa-miR-497 | CAGCAGCACACUGUGGUUUGU | ||||
miR-153 | 1786 | 1792 | 1A | hsa-miR-153 | UUGCAUAGUCACAAAAGUGA |
miR-17-5p/20/93.mr/106/519.d | 1824 | 1831 | 1A,m8 | hsa-miR-17-5p | CAAAGUGCUUACAGUGCAGGUAGU |
hsa-miR-20abrain | UAAAGUGCUUAUAGUGCAGGUAG | ||||
hsa-miR-106a | AAAAGUGCUUACAGUGCAGGUAGC | ||||
hsa-miR-106bSZ | UAAAGUGCUGACAGUGCAGAU | ||||
hsa-miR-20bSZ | CAAAGUGCUCAUAGUGCAGGUAG | ||||
hsa-miR-519d | CAAAGUGCCUCCCUUUAGAGUGU | ||||
miR-194 | 3176 | 3182 | 1A | hsa-miR-194 | UGUAACAGCAACUCCAUGUGGA |
miR-200bc/429 | 2857 | 2863 | m8 | hsa-miR-200b | UAAUACUGCCUGGUAAUGAUGAC |
hsa-miR-200c | UAAUACUGCCGGGUAAUGAUGG | ||||
hsa-miR-429 | UAAUACUGUCUGGUAAAACCGU | ||||
hsa-miR-200b | UAAUACUGCCUGGUAAUGAUGAC | ||||
hsa-miR-200c | UAAUACUGCCGGGUAAUGAUGG | ||||
hsa-miR-429 | UAAUACUGUCUGGUAAAACCGU | ||||
miR-21 | 564 | 570 | 1A | hsa-miR-21brain | UAGCUUAUCAGACUGAUGUUGA |
hsa-miR-590 | GAGCUUAUUCAUAAAAGUGCAG | ||||
miR-24* | 3057 | 3064 | 1A,m8 | hsa-miR-189 | GUGCCUACUGAGCUGAUAUCAGU |
miR-25/32/92/363/367 | 272 | 278 | m8 | hsa-miR-25brain | CAUUGCACUUGUCUCGGUCUGA |
hsa-miR-32 | UAUUGCACAUUACUAAGUUGC | ||||
hsa-miR-92 | UAUUGCACUUGUCCCGGCCUG | ||||
hsa-miR-367 | AAUUGCACUUUAGCAAUGGUGA | ||||
hsa-miR-92bSZ | UAUUGCACUCGUCCCGGCCUC | ||||
miR-30-5p | 870 | 876 | m8 | hsa-miR-30a-5p | UGUAAACAUCCUCGACUGGAAG |
hsa-miR-30cbrain | UGUAAACAUCCUACACUCUCAGC | ||||
hsa-miR-30dSZ | UGUAAACAUCCCCGACUGGAAG | ||||
hsa-miR-30bSZ | UGUAAACAUCCUACACUCAGCU | ||||
hsa-miR-30e-5p | UGUAAACAUCCUUGACUGGA | ||||
miR-34/449 | 2730 | 2737 | 1A,m8 | hsa-miR-34abrain | UGGCAGUGUCUUAGCUGGUUGUU |
hsa-miR-34c | AGGCAGUGUAGUUAGCUGAUUGC | ||||
hsa-miR-449 | UGGCAGUGUAUUGUUAGCUGGU | ||||
hsa-miR-449b | AGGCAGUGUAUUGUUAGCUGGC | ||||
miR-342 | 1252 | 1258 | m8 | hsa-miR-342brain | UCUCACACAGAAAUCGCACCCGUC |
miR-370 | 1111 | 1117 | m8 | hsa-miR-370brain | GCCUGCUGGGGUGGAACCUGG |
miR-378 | 1429 | 1435 | 1A | hsa-miR-378 | CUCCUGACUCCAGGUCCUGUGU |
hsa-miR-378 | CUCCUGACUCCAGGUCCUGUGU | ||||
miR-433-3p | 107 | 114 | 1A,m8 | hsa-miR-433brain | AUCAUGAUGGGCUCCUCGGUGU |
miR-448 | 1785 | 1792 | 1A,m8 | hsa-miR-448 | UUGCAUAUGUAGGAUGUCCCAU |
miR-495 | 3174 | 3180 | 1A | hsa-miR-495brain | AAACAAACAUGGUGCACUUCUUU |
miR-496 | 3125 | 3131 | 1A | hsa-miR-496 | AUUACAUGGCCAAUCUC |
miR-500 | 1880 | 1886 | m8 | hsa-miR-500 | AUGCACCUGGGCAAGGAUUCUG |
miR-503 | 2492 | 2498 | 1A | hsa-miR-503 | UAGCAGCGGGAACAGUUCUGCAG |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.