SZGR2

Summary ?

GeneID	1879
Symbol	EBF1
Synonyms	COE1\|EBF\|O/E-1\|OLF1
Description	early B-cell factor 1
Reference	MIM:164343\|HGNC:HGNC:3126\|Ensembl:ENSG00000164330\|HPRD:01256\|Vega:OTTHUMG00000130304
Gene type	protein-coding
Map location	5q34
Pascal p-value	0.016
Fetal beta	-0.488
DMG	1 (# studies)
eGene	Myers' cis & trans

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Wockner_2014	Genome-wide DNA methylation analysis	This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24).	1
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
GSMA_I	Genome scan meta-analysis	Psr: 0.0032
GSMA_IIA	Genome scan meta-analysis (All samples)	Psr: 0.00459
GSMA_IIE	Genome scan meta-analysis (European-ancestry samples)	Psr: 0.01718
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias	Click to show details

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg00251610	5	158527817	EBF1	1.237E-4	-0.38	0.03	DMG:Wockner_2014

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	qvalue	eQTL type
snp_a-1919794		0	EBF1	1879	0.09	trans
rs12104712	chr2	82644947	EBF1	1879	0.04	trans
rs7584986	chr2	184111432	EBF1	1879	2.686E-4	trans
rs6729020	chr2	189064719	EBF1	1879	0.06	trans
rs10491487	chr5	80323367	EBF1	1879	0.01	trans
rs1368303	chr5	147672388	EBF1	1879	5.325E-4	trans
rs9364293	chr6	169199078	EBF1	1879	0.04	trans
snp_a-2077565		0	EBF1	1879	0.16	trans
rs6574467	chr14	79179744	EBF1	1879	0.15	trans
rs10146003	chr14	79191170	EBF1	1879	0.15	trans
rs16955618	chr15	29937543	EBF1	1879	0	trans
rs17070739	chr18	60819382	EBF1	1879	0.08	trans
rs17085767	chr18	69839397	EBF1	1879	3.098E-4	trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
PEMT	0.77	0.72
SLC25A39	0.76	0.72
CHID1	0.76	0.70
PEX10	0.76	0.70
PSMD9	0.74	0.70
CRELD2	0.74	0.68
C21orf33	0.74	0.72
TUFM	0.73	0.69
RUVBL2	0.73	0.67
TAF6L	0.73	0.69

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
MT-ATP8	-0.44	-0.44
AF347015.27	-0.44	-0.42
AF347015.8	-0.43	-0.40
AF347015.21	-0.42	-0.38
AF347015.31	-0.41	-0.38
MT-CYB	-0.39	-0.37
MT-CO2	-0.39	-0.38
AF347015.33	-0.39	-0.38
AF347015.2	-0.39	-0.41
AF347015.15	-0.38	-0.38

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0003700	transcription factor activity	IEA		-
GO:0005515	protein binding	IDA		14594818
GO:0008270	zinc ion binding	IEA		-
GO:0046872	metal ion binding	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0006355	regulation of transcription, DNA-dependent	IEA		-
GO:0007275	multicellular organismal development	IEA		-
GO:0045941	positive regulation of transcription	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005634	nucleus	IEA		-

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
REACTOME DEVELOPMENTAL BIOLOGY	396	292	All SZGR 2.0 genes in this pathway
REACTOME TRANSCRIPTIONAL REGULATION OF WHITE ADIPOCYTE DIFFERENTIATION	72	53	All SZGR 2.0 genes in this pathway
VECCHI GASTRIC CANCER EARLY DN	367	220	All SZGR 2.0 genes in this pathway
SENESE HDAC1 TARGETS DN	260	143	All SZGR 2.0 genes in this pathway
SENESE HDAC1 AND HDAC2 TARGETS DN	232	139	All SZGR 2.0 genes in this pathway
KINSEY TARGETS OF EWSR1 FLII FUSION DN	329	219	All SZGR 2.0 genes in this pathway
DODD NASOPHARYNGEAL CARCINOMA UP	1821	933	All SZGR 2.0 genes in this pathway
LINDGREN BLADDER CANCER CLUSTER 1 DN	378	231	All SZGR 2.0 genes in this pathway
GAUSSMANN MLL AF4 FUSION TARGETS A UP	191	128	All SZGR 2.0 genes in this pathway
BERENJENO TRANSFORMED BY RHOA DN	394	258	All SZGR 2.0 genes in this pathway
RIZ ERYTHROID DIFFERENTIATION 6HR	40	23	All SZGR 2.0 genes in this pathway
KLEIN TARGETS OF BCR ABL1 FUSION	45	34	All SZGR 2.0 genes in this pathway
LINDGREN BLADDER CANCER CLUSTER 2B	392	251	All SZGR 2.0 genes in this pathway
KREPPEL CD99 TARGETS DN	8	5	All SZGR 2.0 genes in this pathway
PASQUALUCCI LYMPHOMA BY GC STAGE DN	165	104	All SZGR 2.0 genes in this pathway
BENPORATH EED TARGETS	1062	725	All SZGR 2.0 genes in this pathway
BENPORATH ES WITH H3K27ME3	1118	744	All SZGR 2.0 genes in this pathway
MORI EMU MYC LYMPHOMA BY ONSET TIME UP	110	69	All SZGR 2.0 genes in this pathway
SHEPARD CRUSH AND BURN MUTANT DN	185	111	All SZGR 2.0 genes in this pathway
LU IL4 SIGNALING	94	56	All SZGR 2.0 genes in this pathway
WANG IMMORTALIZED BY HOXA9 AND MEIS1 DN	24	15	All SZGR 2.0 genes in this pathway
MATSUDA NATURAL KILLER DIFFERENTIATION	475	313	All SZGR 2.0 genes in this pathway
KUMAR TARGETS OF MLL AF9 FUSION	405	264	All SZGR 2.0 genes in this pathway
CUI TCF21 TARGETS 2 DN	830	547	All SZGR 2.0 genes in this pathway
MASSARWEH TAMOXIFEN RESISTANCE UP	578	341	All SZGR 2.0 genes in this pathway
IWANAGA CARCINOGENESIS BY KRAS PTEN DN	353	226	All SZGR 2.0 genes in this pathway
YAMASHITA METHYLATED IN PROSTATE CANCER	57	29	All SZGR 2.0 genes in this pathway
RIGGI EWING SARCOMA PROGENITOR DN	191	123	All SZGR 2.0 genes in this pathway
BOYLAN MULTIPLE MYELOMA C D UP	139	95	All SZGR 2.0 genes in this pathway
BOYLAN MULTIPLE MYELOMA C UP	47	29	All SZGR 2.0 genes in this pathway
MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3	1069	729	All SZGR 2.0 genes in this pathway
YAO TEMPORAL RESPONSE TO PROGESTERONE CLUSTER 12	79	54	All SZGR 2.0 genes in this pathway
CHYLA CBFA2T3 TARGETS UP	387	225	All SZGR 2.0 genes in this pathway
DUAN PRDM5 TARGETS	79	52	All SZGR 2.0 genes in this pathway
WAKABAYASHI ADIPOGENESIS PPARG BOUND 8D	658	397	All SZGR 2.0 genes in this pathway
WANG MLL TARGETS	289	188	All SZGR 2.0 genes in this pathway
PEDRIOLI MIR31 TARGETS DN	418	245	All SZGR 2.0 genes in this pathway
PECE MAMMARY STEM CELL DN	146	88	All SZGR 2.0 genes in this pathway
ZWANG TRANSIENTLY UP BY 2ND EGF PULSE ONLY	1725	838	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-124.1	520	526	1A	hsa-miR-124a	UUAAGGCACGCGGUGAAUGCCA
miR-129-5p	424	430	1A	hsa-miR-129^brain	CUUUUUGCGGUCUGGGCUUGC
miR-129-5p	424	430	1A	hsa-miR-129-5p	CUUUUUGCGGUCUGGGCUUGCU
miR-208	628	634	1A	hsa-miR-208	AUAAGACGAGCAAAAAGCUUGU
miR-499	628	634	1A	hsa-miR-499	UUAAGACUUGCAGUGAUGUUUAA

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: EBF1