Gene Page: CREG2
Summary ?
| GeneID | 200407 |
| Symbol | CREG2 |
| Synonyms | - |
| Description | cellular repressor of E1A stimulated genes 2 |
| Reference | HGNC:HGNC:14272|HPRD:16753| |
| Gene type | protein-coding |
| Map location | 2q11.2 |
| Pascal p-value | 0.031 |
| Sherlock p-value | 0.661 |
| eGene | Myers' cis & trans |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| GSMA_I | Genome scan meta-analysis | Psr: 0.0004 |
Section I. Genetics and epigenetics annotation
eQTL annotation
| SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
|---|---|---|---|---|---|---|---|---|
| rs17014160 | chr1 | 206855799 | CREG2 | 200407 | 0 | trans | ||
| snp_a-2090942 | 0 | CREG2 | 200407 | 0.01 | trans | |||
| rs17014165 | chr1 | 206856485 | CREG2 | 200407 | 0.01 | trans | ||
| snp_a-2305437 | 0 | CREG2 | 200407 | 0.04 | trans | |||
| snp_a-4300010 | 0 | CREG2 | 200407 | 0.04 | trans | |||
| rs6813178 | chr4 | 71575238 | CREG2 | 200407 | 4.665E-5 | trans | ||
| rs6447043 | chr4 | 71592053 | CREG2 | 200407 | 0.18 | trans | ||
| rs17146240 | chr5 | 119522933 | CREG2 | 200407 | 0 | trans | ||
| rs17146261 | chr5 | 119534252 | CREG2 | 200407 | 0 | trans | ||
| rs2131824 | chr6 | 125775939 | CREG2 | 200407 | 0.09 | trans | ||
| rs2248 | chr6 | 125777720 | CREG2 | 200407 | 0.09 | trans | ||
| rs1494158 | chr6 | 125785156 | CREG2 | 200407 | 0.09 | trans | ||
| rs4901739 | chr14 | 57345856 | CREG2 | 200407 | 0.03 | trans | ||
| rs6015314 | chr20 | 57167224 | CREG2 | 200407 | 0.01 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0005794 | Golgi apparatus | IEA | - | |
| GO:0005576 | extracellular region | IEA | - | |
| GO:0005783 | endoplasmic reticulum | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| BENPORATH EED TARGETS | 1062 | 725 | All SZGR 2.0 genes in this pathway |
| STARK PREFRONTAL CORTEX 22Q11 DELETION UP | 195 | 138 | All SZGR 2.0 genes in this pathway |
| MEISSNER NPC HCP WITH H3K4ME2 | 491 | 319 | All SZGR 2.0 genes in this pathway |
| ACEVEDO FGFR1 TARGETS IN PROSTATE CANCER MODEL DN | 308 | 187 | All SZGR 2.0 genes in this pathway |
| ZWANG TRANSIENTLY UP BY 1ST EGF PULSE ONLY | 1839 | 928 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-380-5p | 1774 | 1780 | m8 | hsa-miR-380-5p | UGGUUGACCAUAGAACAUGCGC |
| hsa-miR-563 | AGGUUGACAUACGUUUCCC | ||||
| miR-381 | 1415 | 1421 | 1A | hsa-miR-381 | UAUACAAGGGCAAGCUCUCUGU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.