SZGR2

Summary ?

GeneID	2017
Symbol	CTTN
Synonyms	EMS1
Description	cortactin
Reference	MIM:164765\|HGNC:HGNC:3338\|Ensembl:ENSG00000085733\|HPRD:01268\|Vega:OTTHUMG00000134307
Gene type	protein-coding
Map location	11q13
Pascal p-value	0.195
Sherlock p-value	0.823
Fetal beta	-0.259
DMG	1 (# studies)
eGene	Myers' cis & trans
Support	CELL ADHESION AND TRANSSYNAPTIC SIGNALING G2Cdb.humanNRC G2Cdb.humanPSD G2Cdb.humanPSP Ascano FMRP targets Potential synaptic genes

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Nishioka_2013	Genome-wide DNA methylation analysis	The authors investigated the methylation profiles of DNA in peripheral blood cells from 18 patients with first-episode schizophrenia (FESZ) and from 15 normal controls.	1
Network	Shortest path distance of core genes in the Human protein-protein interaction network	Contribution to shortest path in PPI network: 0.0836

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg15383392	11	70244691	CTTN		-0.022	0.55	DMG:Nishioka_2013

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	pvalue	qvalue	TSS distance	eQTL type
rs7120675	chr11	71050680	CTTN	2017		0.2		cis

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005515	protein binding	IEA		-
GO:0005515	protein binding	ISS		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0001726	ruffle	ISS		-
GO:0005856	cytoskeleton	TAS		9054437
GO:0005625	soluble fraction	TAS		9054437
GO:0005737	cytoplasm	IEA		-
GO:0005737	cytoplasm	ISS		-
GO:0030027	lamellipodium	IEA		-
GO:0030027	lamellipodium	ISS		-
GO:0005938	cell cortex	IEA		-
GO:0005938	cell cortex	ISS		-

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
ACTR2	ARP2	ARP2 actin-related protein 2 homolog (yeast)	Affinity Capture-MS	BioGRID	11018051
ACTR3	ARP3	ARP3 actin-related protein 3 homolog (yeast)	-	HPRD,BioGRID	12176742
ARHGAP17	DKFZp564A1363 \| FLJ37567 \| FLJ43368 \| MGC87805 \| MST066 \| MST110 \| MSTP038 \| MSTP066 \| MSTP110 \| NADRIN \| RICH1 \| WBP15	Rho GTPase activating protein 17	Reconstituted Complex	BioGRID	11431473
ARHGAP8	BPGAP1 \| FLJ20185 \| PP610	Rho GTPase activating protein 8	BPGAP1 interacts with Cortactin.	BIND	15064355
ARPC2	ARC34 \| PNAS-139 \| PRO2446 \| p34-Arc	actin related protein 2/3 complex, subunit 2, 34kDa	Affinity Capture-MS Affinity Capture-Western	BioGRID	11018051
ARPC3	ARC21 \| p21-Arc	actin related protein 2/3 complex, subunit 3, 21kDa	Affinity Capture-MS	BioGRID	11018051
ARPC4	ARC20 \| MGC13544 \| p20-Arc	actin related protein 2/3 complex, subunit 4, 20kDa	Affinity Capture-MS	BioGRID	11018051
ASAP1	AMAP1 \| CENTB4 \| DDEF1 \| KIAA1249 \| PAG2 \| PAP \| ZG14P	ArfGAP with SH3 domain, ankyrin repeat and PH domain 1	DDEF1 (AMAP1) interacts with an unspecified isoform of CTTN (cortactin).	BIND	15719014
CASP3	CPP32 \| CPP32B \| SCA-1	caspase 3, apoptosis-related cysteine peptidase	Biochemical Activity	BioGRID	11689006
CHD3	Mi-2a \| Mi2-ALPHA \| ZFH	chromodomain helicase DNA binding protein 3	Two-hybrid	BioGRID	16169070
CRB2	FLJ16786 \| FLJ38464	crumbs homolog 2 (Drosophila)	Affinity Capture-Western	BioGRID	11439336
CTNND1	CAS \| CTNND \| KIAA0384 \| P120CAS \| P120CTN \| p120	catenin (cadherin-associated protein), delta 1	-	HPRD,BioGRID	12835311
CTNND2	GT24 \| NPRAP	catenin (cadherin-associated protein), delta 2 (neural plakophilin-related arm-repeat protein)	-	HPRD	12835311
DNM1	DNM	dynamin 1	-	HPRD	12419186
DNM2	CMTDI1 \| CMTDIB \| DI-CMTB \| DYN2 \| DYNII	dynamin 2	-	HPRD	12419186
FER	TYK3	fer (fps/fes related) tyrosine kinase	-	HPRD,BioGRID	9722593
FGD1	AAS \| FGDY \| ZFYVE3	FYVE, RhoGEF and PH domain containing 1	-	HPRD	12913069
GRB2	ASH \| EGFRBP-GRB2 \| Grb3-3 \| MST084 \| MSTP084	growth factor receptor-bound protein 2	-	HPRD	11439336
KCNA2	HBK5 \| HK4 \| HUKIV \| KV1.2 \| MGC50217 \| MK2 \| NGK1 \| RBK2	potassium voltage-gated channel, shaker-related subfamily, member 2	-	HPRD,BioGRID	12151401
MYLK	DKFZp686I10125 \| FLJ12216 \| KRP \| MLCK \| MLCK1 \| MLCK108 \| MLCK210 \| MSTP083 \| MYLK1 \| smMLCK	myosin light chain kinase	-	HPRD,BioGRID	12408982
PXN	FLJ16691	paxillin	PXN (Paxillin) interacts with an unspecified isoform of CTTN (cortactin).	BIND	15719014
SDC3	N-syndecan \| SDCN \| SYND3	syndecan 3	-	HPRD,BioGRID	9553134
SHANK2	CORTBP1 \| CTTNBP1 \| ProSAP1 \| SHANK \| SPANK-3	SH3 and multiple ankyrin repeat domains 2	-	HPRD,BioGRID	9742101
SYK	DKFZp313N1010 \| FLJ25043 \| FLJ37489	spleen tyrosine kinase	-	HPRD,BioGRID	8636079
TJP1	DKFZp686M05161 \| MGC133289 \| ZO-1	tight junction protein 1 (zona occludens 1)	-	HPRD	9792678\|11018051
WASL	DKFZp779G0847 \| MGC48327 \| N-WASP \| NWASP	Wiskott-Aldrich syndrome-like	-	HPRD,BioGRID	11830518
WIPF1	MGC111041 \| PRPL-2 \| WASPIP \| WIP	WAS/WASL interacting protein family, member 1	-	HPRD,BioGRID	12620186

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG TIGHT JUNCTION	134	86	All SZGR 2.0 genes in this pathway
KEGG PATHOGENIC ESCHERICHIA COLI INFECTION	59	36	All SZGR 2.0 genes in this pathway
BIOCARTA AGR PATHWAY	36	31	All SZGR 2.0 genes in this pathway
PID ECADHERIN NASCENT AJ PATHWAY	39	33	All SZGR 2.0 genes in this pathway
PID PDGFRB PATHWAY	129	103	All SZGR 2.0 genes in this pathway
PID SYNDECAN 3 PATHWAY	17	15	All SZGR 2.0 genes in this pathway
PID NCADHERIN PATHWAY	33	32	All SZGR 2.0 genes in this pathway
PID FGF PATHWAY	55	37	All SZGR 2.0 genes in this pathway
PYEON HPV POSITIVE TUMORS DN	10	5	All SZGR 2.0 genes in this pathway
ONKEN UVEAL MELANOMA UP	783	507	All SZGR 2.0 genes in this pathway
BORCZUK MALIGNANT MESOTHELIOMA DN	104	59	All SZGR 2.0 genes in this pathway
GINESTIER BREAST CANCER 20Q13 AMPLIFICATION UP	119	66	All SZGR 2.0 genes in this pathway
SENESE HDAC1 TARGETS UP	457	269	All SZGR 2.0 genes in this pathway
SENESE HDAC3 TARGETS UP	501	327	All SZGR 2.0 genes in this pathway
NAGASHIMA NRG1 SIGNALING UP	176	123	All SZGR 2.0 genes in this pathway
JAATINEN HEMATOPOIETIC STEM CELL DN	226	132	All SZGR 2.0 genes in this pathway
DELYS THYROID CANCER UP	443	294	All SZGR 2.0 genes in this pathway
CHIN BREAST CANCER COPY NUMBER UP	27	18	All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN	1781	1082	All SZGR 2.0 genes in this pathway
GRAESSMANN RESPONSE TO MC AND DOXORUBICIN DN	770	415	All SZGR 2.0 genes in this pathway
MAHADEVAN RESPONSE TO MP470 DN	19	11	All SZGR 2.0 genes in this pathway
SNIJDERS AMPLIFIED IN HEAD AND NECK TUMORS	37	27	All SZGR 2.0 genes in this pathway
MARTORIATI MDM4 TARGETS FETAL LIVER DN	514	319	All SZGR 2.0 genes in this pathway
MURATA VIRULENCE OF H PILORI	24	16	All SZGR 2.0 genes in this pathway
SHETH LIVER CANCER VS TXNIP LOSS PAM1	229	137	All SZGR 2.0 genes in this pathway
SPIELMAN LYMPHOBLAST EUROPEAN VS ASIAN UP	479	299	All SZGR 2.0 genes in this pathway
NUYTTEN EZH2 TARGETS UP	1037	673	All SZGR 2.0 genes in this pathway
NAKAYAMA FRA2 TARGETS	43	27	All SZGR 2.0 genes in this pathway
LOPEZ MBD TARGETS	957	597	All SZGR 2.0 genes in this pathway
LIU NASOPHARYNGEAL CARCINOMA	70	38	All SZGR 2.0 genes in this pathway
WEI MYCN TARGETS WITH E BOX	795	478	All SZGR 2.0 genes in this pathway
NIKOLSKY BREAST CANCER 11Q12 Q14 AMPLICON	158	93	All SZGR 2.0 genes in this pathway
DING LUNG CANCER EXPRESSION BY COPY NUMBER	100	62	All SZGR 2.0 genes in this pathway
ONDER CDH1 TARGETS 1 UP	140	85	All SZGR 2.0 genes in this pathway
PENG GLUCOSE DEPRIVATION UP	48	26	All SZGR 2.0 genes in this pathway
PENG RAPAMYCIN RESPONSE UP	203	130	All SZGR 2.0 genes in this pathway
STONER ESOPHAGEAL CARCINOGENESIS UP	39	25	All SZGR 2.0 genes in this pathway
ZHAN MULTIPLE MYELOMA LB UP	48	28	All SZGR 2.0 genes in this pathway
MENSE HYPOXIA UP	98	71	All SZGR 2.0 genes in this pathway
REN ALVEOLAR RHABDOMYOSARCOMA DN	408	274	All SZGR 2.0 genes in this pathway
KAAB FAILED HEART ATRIUM DN	141	99	All SZGR 2.0 genes in this pathway
RAMALHO STEMNESS UP	206	118	All SZGR 2.0 genes in this pathway
SIMBULAN PARP1 TARGETS UP	31	23	All SZGR 2.0 genes in this pathway
WEIGEL OXIDATIVE STRESS BY HNE AND TBH	60	42	All SZGR 2.0 genes in this pathway
BURTON ADIPOGENESIS 7	51	34	All SZGR 2.0 genes in this pathway
RAMPON ENRICHED LEARNING ENVIRONMENT LATE UP	22	16	All SZGR 2.0 genes in this pathway
JI RESPONSE TO FSH UP	74	56	All SZGR 2.0 genes in this pathway
KRIGE RESPONSE TO TOSEDOSTAT 6HR UP	953	554	All SZGR 2.0 genes in this pathway
KRIGE RESPONSE TO TOSEDOSTAT 24HR UP	783	442	All SZGR 2.0 genes in this pathway
GAVIN FOXP3 TARGETS CLUSTER P4	100	62	All SZGR 2.0 genes in this pathway
FOSTER TOLERANT MACROPHAGE UP	156	92	All SZGR 2.0 genes in this pathway
HELLER HDAC TARGETS UP	317	208	All SZGR 2.0 genes in this pathway
AMUNDSON POOR SURVIVAL AFTER GAMMA RADIATION 2G	171	96	All SZGR 2.0 genes in this pathway
MARTINEZ RB1 TARGETS DN	543	317	All SZGR 2.0 genes in this pathway
MARTINEZ TP53 TARGETS UP	602	364	All SZGR 2.0 genes in this pathway
MARTINEZ RB1 AND TP53 TARGETS UP	601	369	All SZGR 2.0 genes in this pathway
SAGIV CD24 TARGETS DN	46	26	All SZGR 2.0 genes in this pathway
GRADE COLON CANCER UP	871	505	All SZGR 2.0 genes in this pathway
WEST ADRENOCORTICAL TUMOR DN	546	362	All SZGR 2.0 genes in this pathway
CLIMENT BREAST CANCER COPY NUMBER UP	23	20	All SZGR 2.0 genes in this pathway
BOYLAN MULTIPLE MYELOMA C D DN	252	155	All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS DN	366	257	All SZGR 2.0 genes in this pathway
SHEDDEN LUNG CANCER GOOD SURVIVAL A12	317	177	All SZGR 2.0 genes in this pathway
FONTAINE PAPILLARY THYROID CARCINOMA UP	66	38	All SZGR 2.0 genes in this pathway
RAGHAVACHARI PLATELET SPECIFIC GENES	70	46	All SZGR 2.0 genes in this pathway
PILON KLF1 TARGETS UP	504	321	All SZGR 2.0 genes in this pathway
JOHNSTONE PARVB TARGETS 3 UP	430	288	All SZGR 2.0 genes in this pathway
JOHNSTONE PARVB TARGETS 3 DN	918	550	All SZGR 2.0 genes in this pathway
FEVR CTNNB1 TARGETS UP	682	433	All SZGR 2.0 genes in this pathway
TORCHIA TARGETS OF EWSR1 FLI1 FUSION UP	271	165	All SZGR 2.0 genes in this pathway
PURBEY TARGETS OF CTBP1 NOT SATB1 DN	448	282	All SZGR 2.0 genes in this pathway
PEDERSEN METASTASIS BY ERBB2 ISOFORM 7	403	240	All SZGR 2.0 genes in this pathway
DELACROIX RARG BOUND MEF	367	231	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-221/222	1348	1354	1A	hsa-miR-221^brain	AGCUACAUUGUCUGCUGGGUUUC
miR-221/222	1348	1354	1A	hsa-miR-222^brain	AGCUACAUCUGGCUACUGGGUCUC

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: CTTN