Gene Page: EPHA3
Summary ?
GeneID | 2042 |
Symbol | EPHA3 |
Synonyms | EK4|ETK|ETK1|HEK|HEK4|TYRO4 |
Description | EPH receptor A3 |
Reference | MIM:179611|HGNC:HGNC:3387|Ensembl:ENSG00000044524|HPRD:01555|Vega:OTTHUMG00000159040 |
Gene type | protein-coding |
Map location | 3p11.2 |
Pascal p-value | 0.291 |
Fetal beta | 3.303 |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.04047 | |
GSMA_IIE | Genome scan meta-analysis (European-ancestry samples) | Psr: 0.04359 | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
DGAT1 | 0.77 | 0.72 |
FBXO17 | 0.75 | 0.75 |
TMEM161A | 0.75 | 0.78 |
LRRC4B | 0.75 | 0.73 |
RNF126 | 0.74 | 0.75 |
TMEM180 | 0.74 | 0.72 |
CHST12 | 0.74 | 0.72 |
AGPAT1 | 0.74 | 0.73 |
VAC14 | 0.74 | 0.71 |
SCAP | 0.73 | 0.71 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
AF347015.21 | -0.55 | -0.52 |
AL139819.3 | -0.53 | -0.55 |
AF347015.8 | -0.51 | -0.47 |
AF347015.31 | -0.50 | -0.46 |
AF347015.27 | -0.49 | -0.48 |
MT-ATP8 | -0.49 | -0.49 |
MT-CO2 | -0.49 | -0.45 |
MT-CYB | -0.48 | -0.44 |
NOSTRIN | -0.47 | -0.42 |
AF347015.18 | -0.46 | -0.51 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0000166 | nucleotide binding | IEA | - | |
GO:0004872 | receptor activity | IEA | - | |
GO:0005003 | ephrin receptor activity | IEA | - | |
GO:0005524 | ATP binding | IEA | - | |
GO:0016740 | transferase activity | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0007169 | transmembrane receptor protein tyrosine kinase signaling pathway | IEA | - | |
GO:0006468 | protein amino acid phosphorylation | IEA | - | |
GO:0007165 | signal transduction | TAS | 1737782 | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005576 | extracellular region | IEA | - | |
GO:0016020 | membrane | IEA | - | |
GO:0016021 | integral to membrane | IEA | - | |
GO:0005886 | plasma membrane | IEA | - | |
GO:0005887 | integral to plasma membrane | TAS | 1737782 |
Section IV. Protein-protein interaction annotation
Interactors | Aliases B | Official full name B | Experimental | Source | PubMed ID |
---|---|---|---|---|---|
CRK | CRKII | v-crk sarcoma virus CT10 oncogene homolog (avian) | - | HPRD,BioGRID | 11870224 |
EFNA1 | B61 | ECKLG | EFL1 | EPLG1 | LERK1 | TNFAIP4 | ephrin-A1 | Reconstituted Complex | BioGRID | 9195962 |
EFNA2 | ELF-1 | EPLG6 | HEK7-L | LERK6 | ephrin-A2 | - | HPRD | 9751130 |
EFNA3 | EFL2 | EPLG3 | Ehk1-L | LERK3 | ephrin-A3 | Reconstituted Complex | BioGRID | 9195962 |
EFNA4 | EFL4 | EPLG4 | LERK4 | MGC125826 | ephrin-A4 | Reconstituted Complex | BioGRID | 9195962 |
EFNA5 | AF1 | EFL5 | EPLG7 | GLC1M | LERK7 | RAGS | ephrin-A5 | - | HPRD,BioGRID | 9195962 |
EFNA5 | AF1 | EFL5 | EPLG7 | GLC1M | LERK7 | RAGS | ephrin-A5 | - | HPRD | 9195962|9751130 |
EFNB1 | CFND | CFNS | EFL3 | EPLG2 | Elk-L | LERK2 | MGC8782 | ephrin-B1 | Reconstituted Complex | BioGRID | 9195962 |
EFNB2 | EPLG5 | HTKL | Htk-L | LERK5 | MGC126226 | MGC126227 | MGC126228 | ephrin-B2 | - | HPRD,BioGRID | 8559144 |
RUFY1 | FLJ22251 | RABIP4 | ZFYVE12 | RUN and FYVE domain containing 1 | - | HPRD | 11877430 |
RUFY2 | FLJ10063 | KIAA1537 | RABIP4R | ZFYVE13 | RUN and FYVE domain containing 2 | - | HPRD | 11877430 |
TP53 | FLJ92943 | LFS1 | TRP53 | p53 | tumor protein p53 | Reconstituted Complex | BioGRID | 15355990 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG AXON GUIDANCE | 129 | 103 | All SZGR 2.0 genes in this pathway |
PID EPHA FWDPATHWAY | 34 | 29 | All SZGR 2.0 genes in this pathway |
BERTUCCI MEDULLARY VS DUCTAL BREAST CANCER DN | 169 | 118 | All SZGR 2.0 genes in this pathway |
DAVICIONI TARGETS OF PAX FOXO1 FUSIONS UP | 255 | 177 | All SZGR 2.0 genes in this pathway |
THUM SYSTOLIC HEART FAILURE UP | 423 | 283 | All SZGR 2.0 genes in this pathway |
KINSEY TARGETS OF EWSR1 FLII FUSION DN | 329 | 219 | All SZGR 2.0 genes in this pathway |
SABATES COLORECTAL ADENOMA DN | 291 | 176 | All SZGR 2.0 genes in this pathway |
GOZGIT ESR1 TARGETS DN | 781 | 465 | All SZGR 2.0 genes in this pathway |
DELYS THYROID CANCER DN | 232 | 154 | All SZGR 2.0 genes in this pathway |
LI CISPLATIN RESISTANCE UP | 28 | 20 | All SZGR 2.0 genes in this pathway |
MARTORIATI MDM4 TARGETS FETAL LIVER DN | 514 | 319 | All SZGR 2.0 genes in this pathway |
NUYTTEN NIPP1 TARGETS UP | 769 | 437 | All SZGR 2.0 genes in this pathway |
SCHAEFFER PROSTATE DEVELOPMENT 12HR UP | 116 | 79 | All SZGR 2.0 genes in this pathway |
SCHAEFFER PROSTATE DEVELOPMENT 48HR UP | 487 | 286 | All SZGR 2.0 genes in this pathway |
BENPORATH ES WITH H3K27ME3 | 1118 | 744 | All SZGR 2.0 genes in this pathway |
MORI SMALL PRE BII LYMPHOCYTE UP | 86 | 57 | All SZGR 2.0 genes in this pathway |
DING LUNG CANCER MUTATED SIGNIFICANTLY | 26 | 22 | All SZGR 2.0 genes in this pathway |
MATSUDA NATURAL KILLER DIFFERENTIATION | 475 | 313 | All SZGR 2.0 genes in this pathway |
HILLION HMGA1B TARGETS | 92 | 68 | All SZGR 2.0 genes in this pathway |
YEGNASUBRAMANIAN PROSTATE CANCER | 128 | 60 | All SZGR 2.0 genes in this pathway |
HELLER HDAC TARGETS SILENCED BY METHYLATION UP | 461 | 298 | All SZGR 2.0 genes in this pathway |
DE YY1 TARGETS DN | 92 | 64 | All SZGR 2.0 genes in this pathway |
RIGGI EWING SARCOMA PROGENITOR UP | 430 | 288 | All SZGR 2.0 genes in this pathway |
SMID BREAST CANCER RELAPSE IN BONE UP | 97 | 61 | All SZGR 2.0 genes in this pathway |
SMID BREAST CANCER BASAL DN | 701 | 446 | All SZGR 2.0 genes in this pathway |
BOQUEST STEM CELL CULTURED VS FRESH UP | 425 | 298 | All SZGR 2.0 genes in this pathway |
YAUCH HEDGEHOG SIGNALING PARACRINE UP | 149 | 85 | All SZGR 2.0 genes in this pathway |
VART KSHV INFECTION ANGIOGENIC MARKERS UP | 165 | 118 | All SZGR 2.0 genes in this pathway |
VART KSHV INFECTION ANGIOGENIC MARKERS DN | 138 | 92 | All SZGR 2.0 genes in this pathway |
MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3 | 1069 | 729 | All SZGR 2.0 genes in this pathway |
WOO LIVER CANCER RECURRENCE UP | 105 | 75 | All SZGR 2.0 genes in this pathway |
CHANDRAN METASTASIS DN | 306 | 191 | All SZGR 2.0 genes in this pathway |
BRUINS UVC RESPONSE VIA TP53 GROUP B | 549 | 316 | All SZGR 2.0 genes in this pathway |
YANG BCL3 TARGETS UP | 364 | 236 | All SZGR 2.0 genes in this pathway |
PLASARI NFIC TARGETS BASAL DN | 18 | 13 | All SZGR 2.0 genes in this pathway |
ACEVEDO FGFR1 TARGETS IN PROSTATE CANCER MODEL DN | 308 | 187 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
let-7/98 | 460 | 466 | 1A | hsa-let-7abrain | UGAGGUAGUAGGUUGUAUAGUU |
hsa-let-7bbrain | UGAGGUAGUAGGUUGUGUGGUU | ||||
hsa-let-7cbrain | UGAGGUAGUAGGUUGUAUGGUU | ||||
hsa-let-7dbrain | AGAGGUAGUAGGUUGCAUAGU | ||||
hsa-let-7ebrain | UGAGGUAGGAGGUUGUAUAGU | ||||
hsa-let-7fbrain | UGAGGUAGUAGAUUGUAUAGUU | ||||
hsa-miR-98brain | UGAGGUAGUAAGUUGUAUUGUU | ||||
hsa-let-7gSZ | UGAGGUAGUAGUUUGUACAGU | ||||
hsa-let-7ibrain | UGAGGUAGUAGUUUGUGCUGU | ||||
miR-124.1 | 135 | 142 | 1A,m8 | hsa-miR-124a | UUAAGGCACGCGGUGAAUGCCA |
miR-124/506 | 135 | 141 | 1A | hsa-miR-506 | UAAGGCACCCUUCUGAGUAGA |
hsa-miR-124brain | UAAGGCACGCGGUGAAUGCC | ||||
miR-135 | 2452 | 2458 | m8 | hsa-miR-135a | UAUGGCUUUUUAUUCCUAUGUGA |
hsa-miR-135b | UAUGGCUUUUCAUUCCUAUGUG | ||||
miR-182 | 712 | 718 | 1A | hsa-miR-182 | UUUGGCAAUGGUAGAACUCACA |
miR-194 | 699 | 705 | 1A | hsa-miR-194 | UGUAACAGCAACUCCAUGUGGA |
miR-29 | 976 | 982 | m8 | hsa-miR-29aSZ | UAGCACCAUCUGAAAUCGGUU |
hsa-miR-29bSZ | UAGCACCAUUUGAAAUCAGUGUU | ||||
hsa-miR-29cSZ | UAGCACCAUUUGAAAUCGGU | ||||
miR-325 | 2272 | 2278 | 1A | hsa-miR-325 | CCUAGUAGGUGUCCAGUAAGUGU |
miR-381 | 930 | 936 | m8 | hsa-miR-381 | UAUACAAGGGCAAGCUCUCUGU |
miR-487b | 2245 | 2251 | m8 | hsa-miR-487b | AAUCGUACAGGGUCAUCCACUU |
miR-488 | 470 | 476 | m8 | hsa-miR-488 | CCCAGAUAAUGGCACUCUCAA |
miR-495 | 697 | 703 | 1A | hsa-miR-495brain | AAACAAACAUGGUGCACUUCUUU |
miR-496 | 2558 | 2564 | 1A | hsa-miR-496 | AUUACAUGGCCAAUCUC |
hsa-miR-496 | AUUACAUGGCCAAUCUC | ||||
hsa-miR-496 | AUUACAUGGCCAAUCUC | ||||
miR-7 | 1296 | 1303 | 1A,m8 | hsa-miR-7SZ | UGGAAGACUAGUGAUUUUGUUG |
miR-96 | 711 | 718 | 1A,m8 | hsa-miR-96brain | UUUGGCACUAGCACAUUUUUGC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.