SZGR2

Summary ?

GeneID	2042
Symbol	EPHA3
Synonyms	EK4\|ETK\|ETK1\|HEK\|HEK4\|TYRO4
Description	EPH receptor A3
Reference	MIM:179611\|HGNC:HGNC:3387\|Ensembl:ENSG00000044524\|HPRD:01555\|Vega:OTTHUMG00000159040
Gene type	protein-coding
Map location	3p11.2
Pascal p-value	0.291
Fetal beta	3.303

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
GSMA_IIA	Genome scan meta-analysis (All samples)	Psr: 0.04047
GSMA_IIE	Genome scan meta-analysis (European-ancestry samples)	Psr: 0.04359
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias	Click to show details

Section I. Genetics and epigenetics annotation

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
DGAT1	0.77	0.72
FBXO17	0.75	0.75
TMEM161A	0.75	0.78
LRRC4B	0.75	0.73
RNF126	0.74	0.75
TMEM180	0.74	0.72
CHST12	0.74	0.72
AGPAT1	0.74	0.73
VAC14	0.74	0.71
SCAP	0.73	0.71

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
AF347015.21	-0.55	-0.52
AL139819.3	-0.53	-0.55
AF347015.8	-0.51	-0.47
AF347015.31	-0.50	-0.46
AF347015.27	-0.49	-0.48
MT-ATP8	-0.49	-0.49
MT-CO2	-0.49	-0.45
MT-CYB	-0.48	-0.44
NOSTRIN	-0.47	-0.42
AF347015.18	-0.46	-0.51

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0000166	nucleotide binding	IEA		-
GO:0004872	receptor activity	IEA		-
GO:0005003	ephrin receptor activity	IEA		-
GO:0005524	ATP binding	IEA		-
GO:0016740	transferase activity	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0007169	transmembrane receptor protein tyrosine kinase signaling pathway	IEA		-
GO:0006468	protein amino acid phosphorylation	IEA		-
GO:0007165	signal transduction	TAS		1737782
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005576	extracellular region	IEA		-
GO:0016020	membrane	IEA		-
GO:0016021	integral to membrane	IEA		-
GO:0005886	plasma membrane	IEA		-
GO:0005887	integral to plasma membrane	TAS		1737782

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
CRK	CRKII	v-crk sarcoma virus CT10 oncogene homolog (avian)	-	HPRD,BioGRID	11870224
EFNA1	B61 \| ECKLG \| EFL1 \| EPLG1 \| LERK1 \| TNFAIP4	ephrin-A1	Reconstituted Complex	BioGRID	9195962
EFNA2	ELF-1 \| EPLG6 \| HEK7-L \| LERK6	ephrin-A2	-	HPRD	9751130
EFNA3	EFL2 \| EPLG3 \| Ehk1-L \| LERK3	ephrin-A3	Reconstituted Complex	BioGRID	9195962
EFNA4	EFL4 \| EPLG4 \| LERK4 \| MGC125826	ephrin-A4	Reconstituted Complex	BioGRID	9195962
EFNA5	AF1 \| EFL5 \| EPLG7 \| GLC1M \| LERK7 \| RAGS	ephrin-A5	-	HPRD,BioGRID	9195962
EFNA5	AF1 \| EFL5 \| EPLG7 \| GLC1M \| LERK7 \| RAGS	ephrin-A5	-	HPRD	9195962\|9751130
EFNB1	CFND \| CFNS \| EFL3 \| EPLG2 \| Elk-L \| LERK2 \| MGC8782	ephrin-B1	Reconstituted Complex	BioGRID	9195962
EFNB2	EPLG5 \| HTKL \| Htk-L \| LERK5 \| MGC126226 \| MGC126227 \| MGC126228	ephrin-B2	-	HPRD,BioGRID	8559144
RUFY1	FLJ22251 \| RABIP4 \| ZFYVE12	RUN and FYVE domain containing 1	-	HPRD	11877430
RUFY2	FLJ10063 \| KIAA1537 \| RABIP4R \| ZFYVE13	RUN and FYVE domain containing 2	-	HPRD	11877430
TP53	FLJ92943 \| LFS1 \| TRP53 \| p53	tumor protein p53	Reconstituted Complex	BioGRID	15355990

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG AXON GUIDANCE	129	103	All SZGR 2.0 genes in this pathway
PID EPHA FWDPATHWAY	34	29	All SZGR 2.0 genes in this pathway
BERTUCCI MEDULLARY VS DUCTAL BREAST CANCER DN	169	118	All SZGR 2.0 genes in this pathway
DAVICIONI TARGETS OF PAX FOXO1 FUSIONS UP	255	177	All SZGR 2.0 genes in this pathway
THUM SYSTOLIC HEART FAILURE UP	423	283	All SZGR 2.0 genes in this pathway
KINSEY TARGETS OF EWSR1 FLII FUSION DN	329	219	All SZGR 2.0 genes in this pathway
SABATES COLORECTAL ADENOMA DN	291	176	All SZGR 2.0 genes in this pathway
GOZGIT ESR1 TARGETS DN	781	465	All SZGR 2.0 genes in this pathway
DELYS THYROID CANCER DN	232	154	All SZGR 2.0 genes in this pathway
LI CISPLATIN RESISTANCE UP	28	20	All SZGR 2.0 genes in this pathway
MARTORIATI MDM4 TARGETS FETAL LIVER DN	514	319	All SZGR 2.0 genes in this pathway
NUYTTEN NIPP1 TARGETS UP	769	437	All SZGR 2.0 genes in this pathway
SCHAEFFER PROSTATE DEVELOPMENT 12HR UP	116	79	All SZGR 2.0 genes in this pathway
SCHAEFFER PROSTATE DEVELOPMENT 48HR UP	487	286	All SZGR 2.0 genes in this pathway
BENPORATH ES WITH H3K27ME3	1118	744	All SZGR 2.0 genes in this pathway
MORI SMALL PRE BII LYMPHOCYTE UP	86	57	All SZGR 2.0 genes in this pathway
DING LUNG CANCER MUTATED SIGNIFICANTLY	26	22	All SZGR 2.0 genes in this pathway
MATSUDA NATURAL KILLER DIFFERENTIATION	475	313	All SZGR 2.0 genes in this pathway
HILLION HMGA1B TARGETS	92	68	All SZGR 2.0 genes in this pathway
YEGNASUBRAMANIAN PROSTATE CANCER	128	60	All SZGR 2.0 genes in this pathway
HELLER HDAC TARGETS SILENCED BY METHYLATION UP	461	298	All SZGR 2.0 genes in this pathway
DE YY1 TARGETS DN	92	64	All SZGR 2.0 genes in this pathway
RIGGI EWING SARCOMA PROGENITOR UP	430	288	All SZGR 2.0 genes in this pathway
SMID BREAST CANCER RELAPSE IN BONE UP	97	61	All SZGR 2.0 genes in this pathway
SMID BREAST CANCER BASAL DN	701	446	All SZGR 2.0 genes in this pathway
BOQUEST STEM CELL CULTURED VS FRESH UP	425	298	All SZGR 2.0 genes in this pathway
YAUCH HEDGEHOG SIGNALING PARACRINE UP	149	85	All SZGR 2.0 genes in this pathway
VART KSHV INFECTION ANGIOGENIC MARKERS UP	165	118	All SZGR 2.0 genes in this pathway
VART KSHV INFECTION ANGIOGENIC MARKERS DN	138	92	All SZGR 2.0 genes in this pathway
MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3	1069	729	All SZGR 2.0 genes in this pathway
WOO LIVER CANCER RECURRENCE UP	105	75	All SZGR 2.0 genes in this pathway
CHANDRAN METASTASIS DN	306	191	All SZGR 2.0 genes in this pathway
BRUINS UVC RESPONSE VIA TP53 GROUP B	549	316	All SZGR 2.0 genes in this pathway
YANG BCL3 TARGETS UP	364	236	All SZGR 2.0 genes in this pathway
PLASARI NFIC TARGETS BASAL DN	18	13	All SZGR 2.0 genes in this pathway
ACEVEDO FGFR1 TARGETS IN PROSTATE CANCER MODEL DN	308	187	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
let-7/98	460	466	1A	hsa-let-7a^brain	UGAGGUAGUAGGUUGUAUAGUU
				hsa-let-7b^brain	UGAGGUAGUAGGUUGUGUGGUU
				hsa-let-7c^brain	UGAGGUAGUAGGUUGUAUGGUU
				hsa-let-7d^brain	AGAGGUAGUAGGUUGCAUAGU
				hsa-let-7e^brain	UGAGGUAGGAGGUUGUAUAGU
				hsa-let-7f^brain	UGAGGUAGUAGAUUGUAUAGUU
				hsa-miR-98^brain	UGAGGUAGUAAGUUGUAUUGUU
				hsa-let-7g^SZ	UGAGGUAGUAGUUUGUACAGU
				hsa-let-7i^brain	UGAGGUAGUAGUUUGUGCUGU
miR-124.1	135	142	1A,m8	hsa-miR-124a	UUAAGGCACGCGGUGAAUGCCA
miR-124/506	135	141	1A	hsa-miR-506	UAAGGCACCCUUCUGAGUAGA
miR-124/506	135	141	1A	hsa-miR-124^brain	UAAGGCACGCGGUGAAUGCC
miR-135	2452	2458	m8	hsa-miR-135a	UAUGGCUUUUUAUUCCUAUGUGA
miR-135	2452	2458	m8	hsa-miR-135b	UAUGGCUUUUCAUUCCUAUGUG
miR-182	712	718	1A	hsa-miR-182	UUUGGCAAUGGUAGAACUCACA
miR-194	699	705	1A	hsa-miR-194	UGUAACAGCAACUCCAUGUGGA
miR-29	976	982	m8	hsa-miR-29a^SZ	UAGCACCAUCUGAAAUCGGUU
				hsa-miR-29b^SZ	UAGCACCAUUUGAAAUCAGUGUU
				hsa-miR-29c^SZ	UAGCACCAUUUGAAAUCGGU
miR-325	2272	2278	1A	hsa-miR-325	CCUAGUAGGUGUCCAGUAAGUGU
miR-381	930	936	m8	hsa-miR-381	UAUACAAGGGCAAGCUCUCUGU
miR-487b	2245	2251	m8	hsa-miR-487b	AAUCGUACAGGGUCAUCCACUU
miR-488	470	476	m8	hsa-miR-488	CCCAGAUAAUGGCACUCUCAA
miR-495	697	703	1A	hsa-miR-495^brain	AAACAAACAUGGUGCACUUCUUU
miR-496	2558	2564	1A	hsa-miR-496	AUUACAUGGCCAAUCUC
				hsa-miR-496	AUUACAUGGCCAAUCUC
				hsa-miR-496	AUUACAUGGCCAAUCUC
miR-7	1296	1303	1A,m8	hsa-miR-7^SZ	UGGAAGACUAGUGAUUUUGUUG
miR-96	711	718	1A,m8	hsa-miR-96^brain	UUUGGCACUAGCACAUUUUUGC

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: EPHA3