Gene Page: EPHB1
Summary ?
GeneID | 2047 |
Symbol | EPHB1 |
Synonyms | ELK|EPHT2|Hek6|NET |
Description | EPH receptor B1 |
Reference | MIM:600600|HGNC:HGNC:3392|Ensembl:ENSG00000154928|HPRD:02790|Vega:OTTHUMG00000159804 |
Gene type | protein-coding |
Map location | 3q22.2 |
Pascal p-value | 0.33 |
Fetal beta | 0.873 |
eGene | Cerebellum Myers' cis & trans |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:GWASdb | Genome-wide Association Studies | GWASdb records for schizophrenia | |
CV:PGCnp | Genome-wide Association Study | GWAS | |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenias | Click to show details |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 |
Section I. Genetics and epigenetics annotation
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs16829545 | chr2 | 151977407 | EPHB1 | 2047 | 2.844E-14 | trans | ||
rs7584986 | chr2 | 184111432 | EPHB1 | 2047 | 0 | trans | ||
rs6741060 | chr2 | 217169088 | EPHB1 | 2047 | 0.06 | trans | ||
snp_a-1815771 | 0 | EPHB1 | 2047 | 0.01 | trans | |||
rs17020035 | chr4 | 93873810 | EPHB1 | 2047 | 0.15 | trans | ||
rs17020058 | chr4 | 93915972 | EPHB1 | 2047 | 0.15 | trans | ||
rs17020066 | chr4 | 93921055 | EPHB1 | 2047 | 0.15 | trans | ||
rs10491487 | chr5 | 80323367 | EPHB1 | 2047 | 0.09 | trans | ||
rs6996695 | chr8 | 77540580 | EPHB1 | 2047 | 0.16 | trans | ||
rs11139334 | chr9 | 84209393 | EPHB1 | 2047 | 9.877E-4 | trans | ||
rs2393316 | chr10 | 59333070 | EPHB1 | 2047 | 0.1 | trans | ||
rs11061703 | chr12 | 1436977 | EPHB1 | 2047 | 0.11 | trans | ||
rs9989228 | chr14 | 37809252 | EPHB1 | 2047 | 0.03 | trans | ||
rs16955618 | chr15 | 29937543 | EPHB1 | 2047 | 5.685E-10 | trans | ||
rs2077735 | chr15 | 58479024 | EPHB1 | 2047 | 0 | trans | ||
rs9941296 | chr16 | 2759498 | EPHB1 | 2047 | 0.17 | trans | ||
rs11873184 | chr18 | 1584081 | EPHB1 | 2047 | 0.07 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0000166 | nucleotide binding | IEA | - | |
GO:0004872 | receptor activity | IEA | - | |
GO:0005003 | ephrin receptor activity | IEA | - | |
GO:0005515 | protein binding | IPI | 8798570 | |
GO:0005524 | ATP binding | IEA | - | |
GO:0016740 | transferase activity | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0007399 | nervous system development | TAS | neurite (GO term level: 5) | 8666391 |
GO:0007169 | transmembrane receptor protein tyrosine kinase signaling pathway | IEA | - | |
GO:0006468 | protein amino acid phosphorylation | IEA | - | |
GO:0007165 | signal transduction | TAS | 8666391 | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005886 | plasma membrane | TAS | 8666391 | |
GO:0005887 | integral to plasma membrane | TAS | 8666391 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG AXON GUIDANCE | 129 | 103 | All SZGR 2.0 genes in this pathway |
BIOCARTA EPHA4 PATHWAY | 10 | 8 | All SZGR 2.0 genes in this pathway |
PID EPHB FWD PATHWAY | 40 | 38 | All SZGR 2.0 genes in this pathway |
PID EPHRINB REV PATHWAY | 30 | 25 | All SZGR 2.0 genes in this pathway |
DOANE RESPONSE TO ANDROGEN UP | 184 | 125 | All SZGR 2.0 genes in this pathway |
SENESE HDAC1 AND HDAC2 TARGETS UP | 238 | 144 | All SZGR 2.0 genes in this pathway |
YEMELYANOV GR TARGETS DN | 10 | 8 | All SZGR 2.0 genes in this pathway |
SCHAEFFER PROSTATE DEVELOPMENT 48HR DN | 428 | 306 | All SZGR 2.0 genes in this pathway |
BENPORATH SUZ12 TARGETS | 1038 | 678 | All SZGR 2.0 genes in this pathway |
BENPORATH EED TARGETS | 1062 | 725 | All SZGR 2.0 genes in this pathway |
BENPORATH ES WITH H3K27ME3 | 1118 | 744 | All SZGR 2.0 genes in this pathway |
BENPORATH PRC2 TARGETS | 652 | 441 | All SZGR 2.0 genes in this pathway |
ZHAN MULTIPLE MYELOMA HP UP | 49 | 26 | All SZGR 2.0 genes in this pathway |
CUI TCF21 TARGETS 2 DN | 830 | 547 | All SZGR 2.0 genes in this pathway |
KIM GASTRIC CANCER CHEMOSENSITIVITY | 103 | 64 | All SZGR 2.0 genes in this pathway |
LEIN MIDBRAIN MARKERS | 82 | 55 | All SZGR 2.0 genes in this pathway |
RIGGI EWING SARCOMA PROGENITOR UP | 430 | 288 | All SZGR 2.0 genes in this pathway |
ZHENG GLIOBLASTOMA PLASTICITY DN | 58 | 39 | All SZGR 2.0 genes in this pathway |
FIRESTEIN PROLIFERATION | 175 | 125 | All SZGR 2.0 genes in this pathway |
VART KSHV INFECTION ANGIOGENIC MARKERS UP | 165 | 118 | All SZGR 2.0 genes in this pathway |
MIKKELSEN MCV6 HCP WITH H3K27ME3 | 435 | 318 | All SZGR 2.0 genes in this pathway |
VERHAAK GLIOBLASTOMA PRONEURAL | 177 | 132 | All SZGR 2.0 genes in this pathway |
LIM MAMMARY STEM CELL UP | 489 | 314 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-129-5p | 661 | 667 | m8 | hsa-miR-129brain | CUUUUUGCGGUCUGGGCUUGC |
hsa-miR-129-5p | CUUUUUGCGGUCUGGGCUUGCU | ||||
miR-140 | 676 | 683 | 1A,m8 | hsa-miR-140brain | AGUGGUUUUACCCUAUGGUAG |
miR-182 | 541 | 548 | 1A,m8 | hsa-miR-182 | UUUGGCAAUGGUAGAACUCACA |
miR-186 | 399 | 405 | m8 | hsa-miR-186 | CAAAGAAUUCUCCUUUUGGGCUU |
miR-28 | 509 | 515 | m8 | hsa-miR-28brain | AAGGAGCUCACAGUCUAUUGAG |
miR-450 | 661 | 667 | 1A | hsa-miR-450 | UUUUUGCGAUGUGUUCCUAAUA |
miR-452 | 781 | 788 | 1A,m8 | hsa-miR-452 | UGUUUGCAGAGGAAACUGAGAC |
miR-539 | 1266 | 1272 | m8 | hsa-miR-539 | GGAGAAAUUAUCCUUGGUGUGU |
miR-96 | 542 | 548 | 1A | hsa-miR-96brain | UUUGGCACUAGCACAUUUUUGC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.