SZGR2

Summary ?

GeneID	2047
Symbol	EPHB1
Synonyms	ELK\|EPHT2\|Hek6\|NET
Description	EPH receptor B1
Reference	MIM:600600\|HGNC:HGNC:3392\|Ensembl:ENSG00000154928\|HPRD:02790\|Vega:OTTHUMG00000159804
Gene type	protein-coding
Map location	3q22.2
Pascal p-value	0.33
Fetal beta	0.873
eGene	Cerebellum Myers' cis & trans

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:GWASdb	Genome-wide Association Studies	GWASdb records for schizophrenia
CV:PGCnp	Genome-wide Association Study	GWAS
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenias	Click to show details
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 1

Section I. Genetics and epigenetics annotation

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	qvalue	eQTL type
rs16829545	chr2	151977407	EPHB1	2047	2.844E-14	trans
rs7584986	chr2	184111432	EPHB1	2047	0	trans
rs6741060	chr2	217169088	EPHB1	2047	0.06	trans
snp_a-1815771		0	EPHB1	2047	0.01	trans
rs17020035	chr4	93873810	EPHB1	2047	0.15	trans
rs17020058	chr4	93915972	EPHB1	2047	0.15	trans
rs17020066	chr4	93921055	EPHB1	2047	0.15	trans
rs10491487	chr5	80323367	EPHB1	2047	0.09	trans
rs6996695	chr8	77540580	EPHB1	2047	0.16	trans
rs11139334	chr9	84209393	EPHB1	2047	9.877E-4	trans
rs2393316	chr10	59333070	EPHB1	2047	0.1	trans
rs11061703	chr12	1436977	EPHB1	2047	0.11	trans
rs9989228	chr14	37809252	EPHB1	2047	0.03	trans
rs16955618	chr15	29937543	EPHB1	2047	5.685E-10	trans
rs2077735	chr15	58479024	EPHB1	2047	0	trans
rs9941296	chr16	2759498	EPHB1	2047	0.17	trans
rs11873184	chr18	1584081	EPHB1	2047	0.07	trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0000166	nucleotide binding	IEA		-
GO:0004872	receptor activity	IEA		-
GO:0005003	ephrin receptor activity	IEA		-
GO:0005515	protein binding	IPI		8798570
GO:0005524	ATP binding	IEA		-
GO:0016740	transferase activity	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0007399	nervous system development	TAS	neurite (GO term level: 5)	8666391
GO:0007169	transmembrane receptor protein tyrosine kinase signaling pathway	IEA		-
GO:0006468	protein amino acid phosphorylation	IEA		-
GO:0007165	signal transduction	TAS		8666391
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005886	plasma membrane	TAS		8666391
GO:0005887	integral to plasma membrane	TAS		8666391

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG AXON GUIDANCE	129	103	All SZGR 2.0 genes in this pathway
BIOCARTA EPHA4 PATHWAY	10	8	All SZGR 2.0 genes in this pathway
PID EPHB FWD PATHWAY	40	38	All SZGR 2.0 genes in this pathway
PID EPHRINB REV PATHWAY	30	25	All SZGR 2.0 genes in this pathway
DOANE RESPONSE TO ANDROGEN UP	184	125	All SZGR 2.0 genes in this pathway
SENESE HDAC1 AND HDAC2 TARGETS UP	238	144	All SZGR 2.0 genes in this pathway
YEMELYANOV GR TARGETS DN	10	8	All SZGR 2.0 genes in this pathway
SCHAEFFER PROSTATE DEVELOPMENT 48HR DN	428	306	All SZGR 2.0 genes in this pathway
BENPORATH SUZ12 TARGETS	1038	678	All SZGR 2.0 genes in this pathway
BENPORATH EED TARGETS	1062	725	All SZGR 2.0 genes in this pathway
BENPORATH ES WITH H3K27ME3	1118	744	All SZGR 2.0 genes in this pathway
BENPORATH PRC2 TARGETS	652	441	All SZGR 2.0 genes in this pathway
ZHAN MULTIPLE MYELOMA HP UP	49	26	All SZGR 2.0 genes in this pathway
CUI TCF21 TARGETS 2 DN	830	547	All SZGR 2.0 genes in this pathway
KIM GASTRIC CANCER CHEMOSENSITIVITY	103	64	All SZGR 2.0 genes in this pathway
LEIN MIDBRAIN MARKERS	82	55	All SZGR 2.0 genes in this pathway
RIGGI EWING SARCOMA PROGENITOR UP	430	288	All SZGR 2.0 genes in this pathway
ZHENG GLIOBLASTOMA PLASTICITY DN	58	39	All SZGR 2.0 genes in this pathway
FIRESTEIN PROLIFERATION	175	125	All SZGR 2.0 genes in this pathway
VART KSHV INFECTION ANGIOGENIC MARKERS UP	165	118	All SZGR 2.0 genes in this pathway
MIKKELSEN MCV6 HCP WITH H3K27ME3	435	318	All SZGR 2.0 genes in this pathway
VERHAAK GLIOBLASTOMA PRONEURAL	177	132	All SZGR 2.0 genes in this pathway
LIM MAMMARY STEM CELL UP	489	314	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-129-5p	661	667	m8	hsa-miR-129^brain	CUUUUUGCGGUCUGGGCUUGC
miR-129-5p	661	667	m8	hsa-miR-129-5p	CUUUUUGCGGUCUGGGCUUGCU
miR-140	676	683	1A,m8	hsa-miR-140^brain	AGUGGUUUUACCCUAUGGUAG
miR-182	541	548	1A,m8	hsa-miR-182	UUUGGCAAUGGUAGAACUCACA
miR-186	399	405	m8	hsa-miR-186	CAAAGAAUUCUCCUUUUGGGCUU
miR-28	509	515	m8	hsa-miR-28^brain	AAGGAGCUCACAGUCUAUUGAG
miR-450	661	667	1A	hsa-miR-450	UUUUUGCGAUGUGUUCCUAAUA
miR-452	781	788	1A,m8	hsa-miR-452	UGUUUGCAGAGGAAACUGAGAC
miR-539	1266	1272	m8	hsa-miR-539	GGAGAAAUUAUCCUUGGUGUGU
miR-96	542	548	1A	hsa-miR-96^brain	UUUGGCACUAGCACAUUUUUGC

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: EPHB1