Gene Page: USF3
Summary ?
| GeneID | 205717 |
| Symbol | USF3 |
| Synonyms | KIAA2018 |
| Description | upstream transcription factor family member 3 |
| Reference | HGNC:HGNC:30494|Ensembl:ENSG00000176542|HPRD:13912|Vega:OTTHUMG00000159322 |
| Gene type | protein-coding |
| Map location | 3q13.2 |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| DNM:Fromer_2014 | Whole Exome Sequencing analysis | This study reported a WES study of 623 schizophrenia trios, reporting DNMs using genomic DNA. |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0003677 | DNA binding | IEA | - | |
| GO:0004571 | mannosyl-oligosaccharide 1,2-alpha-mannosidase activity | IEA | - | |
| GO:0005509 | calcium ion binding | IEA | - | |
| GO:0030528 | transcription regulator activity | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0045449 | regulation of transcription | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005634 | nucleus | IEA | - | |
| GO:0016020 | membrane | IEA | - |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-103/107 | 5948 | 5955 | 1A,m8 | hsa-miR-103brain | AGCAGCAUUGUACAGGGCUAUGA |
| hsa-miR-107brain | AGCAGCAUUGUACAGGGCUAUCA | ||||
| miR-124.1 | 5349 | 5355 | m8 | hsa-miR-124a | UUAAGGCACGCGGUGAAUGCCA |
| miR-124/506 | 5349 | 5355 | 1A | hsa-miR-506 | UAAGGCACCCUUCUGAGUAGA |
| hsa-miR-124brain | UAAGGCACGCGGUGAAUGCC | ||||
| miR-128 | 5964 | 5970 | 1A | hsa-miR-128a | UCACAGUGAACCGGUCUCUUUU |
| hsa-miR-128b | UCACAGUGAACCGGUCUCUUUC | ||||
| miR-133 | 5929 | 5935 | m8 | hsa-miR-133a | UUGGUCCCCUUCAACCAGCUGU |
| hsa-miR-133b | UUGGUCCCCUUCAACCAGCUA | ||||
| miR-199 | 6102 | 6108 | m8 | hsa-miR-199a | CCCAGUGUUCAGACUACCUGUUC |
| hsa-miR-199b | CCCAGUGUUUAGACUAUCUGUUC | ||||
| miR-24 | 5363 | 5370 | 1A,m8 | hsa-miR-24SZ | UGGCUCAGUUCAGCAGGAACAG |
| miR-27 | 5964 | 5971 | 1A,m8 | hsa-miR-27abrain | UUCACAGUGGCUAAGUUCCGC |
| hsa-miR-27bbrain | UUCACAGUGGCUAAGUUCUGC | ||||
| miR-323 | 653 | 659 | m8 | hsa-miR-323brain | GCACAUUACACGGUCGACCUCU |
| miR-381 | 6468 | 6474 | 1A | hsa-miR-381 | UAUACAAGGGCAAGCUCUCUGU |
| miR-500 | 1922 | 1929 | 1A,m8 | hsa-miR-500 | AUGCACCUGGGCAAGGAUUCUG |
| miR-7 | 681 | 687 | m8 | hsa-miR-7SZ | UGGAAGACUAGUGAUUUUGUUG |
| miR-96 | 657 | 663 | m8 | hsa-miR-96brain | UUUGGCACUAGCACAUUUUUGC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.