Gene Page: ALCAM
Summary ?
GeneID | 214 |
Symbol | ALCAM |
Synonyms | CD166|MEMD |
Description | activated leukocyte cell adhesion molecule |
Reference | MIM:601662|HGNC:HGNC:400|Ensembl:ENSG00000170017|HPRD:03389|Vega:OTTHUMG00000159192 |
Gene type | protein-coding |
Map location | 3q13.1 |
Pascal p-value | 0.022 |
Fetal beta | -0.886 |
eGene | Myers' cis & trans |
Support | CELL ADHESION AND TRANSSYNAPTIC SIGNALING CompositeSet |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DNM:Fromer_2014 | Whole Exome Sequencing analysis | This study reported a WES study of 623 schizophrenia trios, reporting DNMs using genomic DNA. | |
GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.04047 | |
GSMA_IIE | Genome scan meta-analysis (European-ancestry samples) | Psr: 0.04359 | |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 4 |
Section I. Genetics and epigenetics annotation
DNM table
Gene | Chromosome | Position | Ref | Alt | Transcript | AA change | Mutation type | Sift | CG46 | Trait | Study |
---|---|---|---|---|---|---|---|---|---|---|---|
ALCAM | chr3 | 105269062 | A | T | NM_001243280 NM_001243281 NM_001627 | p.489N>I p.489N>I p.489N>I | missense missense missense | Schizophrenia | DNM:Fromer_2014 |
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs1578978 | chr8 | 118196802 | ALCAM | 214 | 0.19 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
ALDH4A1 | 0.90 | 0.88 |
ACSBG1 | 0.90 | 0.85 |
HTRA1 | 0.88 | 0.86 |
GPR37L1 | 0.88 | 0.82 |
SELENBP1 | 0.88 | 0.79 |
PBXIP1 | 0.88 | 0.84 |
CHDH | 0.88 | 0.84 |
ATP1A2 | 0.87 | 0.85 |
SFXN5 | 0.86 | 0.84 |
HEPACAM | 0.86 | 0.83 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
FRG1 | -0.56 | -0.63 |
CCAR1 | -0.56 | -0.63 |
AC026786.2 | -0.56 | -0.64 |
RTF1 | -0.55 | -0.58 |
CYP2R1 | -0.54 | -0.62 |
PHF14 | -0.54 | -0.60 |
C11orf57 | -0.53 | -0.66 |
MED19 | -0.53 | -0.54 |
DUSP12 | -0.53 | -0.55 |
AC011491.1 | -0.52 | -0.57 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0005102 | receptor binding | TAS | Neurotransmitter (GO term level: 4) | 7760007 |
GO:0005515 | protein binding | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0008045 | motor axon guidance | IEA | neuron, axon (GO term level: 14) | - |
GO:0007155 | cell adhesion | TAS | 7760007 | |
GO:0007165 | signal transduction | TAS | 7760007 | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0043025 | cell soma | IEA | axon, dendrite (GO term level: 4) | - |
GO:0030424 | axon | IEA | neuron, axon, Neurotransmitter (GO term level: 6) | - |
GO:0016020 | membrane | IEA | - | |
GO:0016021 | integral to membrane | IEA | - | |
GO:0009897 | external side of plasma membrane | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG CELL ADHESION MOLECULES CAMS | 134 | 93 | All SZGR 2.0 genes in this pathway |
REACTOME DEVELOPMENTAL BIOLOGY | 396 | 292 | All SZGR 2.0 genes in this pathway |
REACTOME AXON GUIDANCE | 251 | 188 | All SZGR 2.0 genes in this pathway |
REACTOME L1CAM INTERACTIONS | 86 | 62 | All SZGR 2.0 genes in this pathway |
SENGUPTA NASOPHARYNGEAL CARCINOMA WITH LMP1 UP | 408 | 247 | All SZGR 2.0 genes in this pathway |
FULCHER INFLAMMATORY RESPONSE LECTIN VS LPS UP | 579 | 346 | All SZGR 2.0 genes in this pathway |
CASORELLI ACUTE PROMYELOCYTIC LEUKEMIA UP | 177 | 110 | All SZGR 2.0 genes in this pathway |
HUTTMANN B CLL POOR SURVIVAL DN | 60 | 39 | All SZGR 2.0 genes in this pathway |
DEURIG T CELL PROLYMPHOCYTIC LEUKEMIA DN | 320 | 184 | All SZGR 2.0 genes in this pathway |
LIU VMYB TARGETS UP | 127 | 78 | All SZGR 2.0 genes in this pathway |
DOANE BREAST CANCER CLASSES UP | 72 | 38 | All SZGR 2.0 genes in this pathway |
DOANE RESPONSE TO ANDROGEN UP | 184 | 125 | All SZGR 2.0 genes in this pathway |
DOANE BREAST CANCER ESR1 UP | 112 | 72 | All SZGR 2.0 genes in this pathway |
WANG CLIM2 TARGETS UP | 269 | 146 | All SZGR 2.0 genes in this pathway |
SENESE HDAC3 TARGETS DN | 536 | 332 | All SZGR 2.0 genes in this pathway |
LEE NEURAL CREST STEM CELL UP | 146 | 99 | All SZGR 2.0 genes in this pathway |
RODRIGUES THYROID CARCINOMA DN | 77 | 52 | All SZGR 2.0 genes in this pathway |
GOZGIT ESR1 TARGETS DN | 781 | 465 | All SZGR 2.0 genes in this pathway |
CHOW RASSF1 TARGETS UP | 27 | 17 | All SZGR 2.0 genes in this pathway |
BERENJENO TRANSFORMED BY RHOA REVERSIBLY DN | 29 | 21 | All SZGR 2.0 genes in this pathway |
LINDGREN BLADDER CANCER CLUSTER 2A DN | 141 | 84 | All SZGR 2.0 genes in this pathway |
BERENJENO TRANSFORMED BY RHOA UP | 536 | 340 | All SZGR 2.0 genes in this pathway |
FARMER BREAST CANCER APOCRINE VS LUMINAL | 326 | 213 | All SZGR 2.0 genes in this pathway |
FARMER BREAST CANCER APOCRINE VS BASAL | 330 | 217 | All SZGR 2.0 genes in this pathway |
FARMER BREAST CANCER CLUSTER 7 | 20 | 11 | All SZGR 2.0 genes in this pathway |
DACOSTA UV RESPONSE VIA ERCC3 DN | 855 | 609 | All SZGR 2.0 genes in this pathway |
MARTORIATI MDM4 TARGETS FETAL LIVER DN | 514 | 319 | All SZGR 2.0 genes in this pathway |
BORLAK LIVER CANCER EGF UP | 57 | 41 | All SZGR 2.0 genes in this pathway |
WOOD EBV EBNA1 TARGETS DN | 47 | 33 | All SZGR 2.0 genes in this pathway |
MOHANKUMAR TLX1 TARGETS DN | 193 | 112 | All SZGR 2.0 genes in this pathway |
LI WILMS TUMOR VS FETAL KIDNEY 2 DN | 51 | 42 | All SZGR 2.0 genes in this pathway |
SHETH LIVER CANCER VS TXNIP LOSS PAM1 | 229 | 137 | All SZGR 2.0 genes in this pathway |
WOTTON RUNX TARGETS DN | 29 | 18 | All SZGR 2.0 genes in this pathway |
KOYAMA SEMA3B TARGETS DN | 411 | 249 | All SZGR 2.0 genes in this pathway |
BENPORATH NANOG TARGETS | 988 | 594 | All SZGR 2.0 genes in this pathway |
BENPORATH SOX2 TARGETS | 734 | 436 | All SZGR 2.0 genes in this pathway |
STARK PREFRONTAL CORTEX 22Q11 DELETION DN | 517 | 309 | All SZGR 2.0 genes in this pathway |
GEORGES TARGETS OF MIR192 AND MIR215 | 893 | 528 | All SZGR 2.0 genes in this pathway |
SUNG METASTASIS STROMA UP | 110 | 70 | All SZGR 2.0 genes in this pathway |
ROSS AML WITH PML RARA FUSION | 77 | 62 | All SZGR 2.0 genes in this pathway |
UEDA PERIFERAL CLOCK | 169 | 111 | All SZGR 2.0 genes in this pathway |
OKUMURA INFLAMMATORY RESPONSE LPS | 183 | 115 | All SZGR 2.0 genes in this pathway |
NING CHRONIC OBSTRUCTIVE PULMONARY DISEASE UP | 157 | 105 | All SZGR 2.0 genes in this pathway |
ABBUD LIF SIGNALING 1 DN | 26 | 17 | All SZGR 2.0 genes in this pathway |
BROWN MYELOID CELL DEVELOPMENT UP | 165 | 100 | All SZGR 2.0 genes in this pathway |
LI WILMS TUMOR VS FETAL KIDNEY 1 UP | 182 | 119 | All SZGR 2.0 genes in this pathway |
AFFAR YY1 TARGETS UP | 214 | 133 | All SZGR 2.0 genes in this pathway |
SESTO RESPONSE TO UV C8 | 72 | 56 | All SZGR 2.0 genes in this pathway |
MARTINEZ RESPONSE TO TRABECTEDIN | 50 | 32 | All SZGR 2.0 genes in this pathway |
WELCSH BRCA1 TARGETS UP | 198 | 132 | All SZGR 2.0 genes in this pathway |
HEDENFALK BREAST CANCER BRCA1 VS BRCA2 | 163 | 113 | All SZGR 2.0 genes in this pathway |
BURTON ADIPOGENESIS 11 | 57 | 40 | All SZGR 2.0 genes in this pathway |
XU GH1 AUTOCRINE TARGETS UP | 268 | 157 | All SZGR 2.0 genes in this pathway |
CREIGHTON ENDOCRINE THERAPY RESISTANCE 5 | 482 | 296 | All SZGR 2.0 genes in this pathway |
LEIN NEURON MARKERS | 69 | 45 | All SZGR 2.0 genes in this pathway |
GAVIN FOXP3 TARGETS CLUSTER P4 | 100 | 62 | All SZGR 2.0 genes in this pathway |
RIGGINS TAMOXIFEN RESISTANCE DN | 220 | 147 | All SZGR 2.0 genes in this pathway |
FOSTER TOLERANT MACROPHAGE DN | 409 | 268 | All SZGR 2.0 genes in this pathway |
KONDO PROSTATE CANCER HCP WITH H3K27ME3 | 97 | 72 | All SZGR 2.0 genes in this pathway |
HELLER SILENCED BY METHYLATION UP | 282 | 183 | All SZGR 2.0 genes in this pathway |
HELLER HDAC TARGETS SILENCED BY METHYLATION UP | 461 | 298 | All SZGR 2.0 genes in this pathway |
MASSARWEH TAMOXIFEN RESISTANCE UP | 578 | 341 | All SZGR 2.0 genes in this pathway |
WORSCHECH TUMOR REJECTION UP | 56 | 32 | All SZGR 2.0 genes in this pathway |
ACEVEDO NORMAL TISSUE ADJACENT TO LIVER TUMOR UP | 174 | 96 | All SZGR 2.0 genes in this pathway |
SMID BREAST CANCER RELAPSE IN BRAIN DN | 85 | 58 | All SZGR 2.0 genes in this pathway |
SMID BREAST CANCER ERBB2 UP | 147 | 83 | All SZGR 2.0 genes in this pathway |
SMID BREAST CANCER BASAL DN | 701 | 446 | All SZGR 2.0 genes in this pathway |
ITO PTTG1 TARGETS UP | 12 | 9 | All SZGR 2.0 genes in this pathway |
BOQUEST STEM CELL CULTURED VS FRESH UP | 425 | 298 | All SZGR 2.0 genes in this pathway |
LABBE WNT3A TARGETS UP | 112 | 71 | All SZGR 2.0 genes in this pathway |
LABBE TGFB1 TARGETS DN | 108 | 64 | All SZGR 2.0 genes in this pathway |
HUPER BREAST BASAL VS LUMINAL DN | 59 | 44 | All SZGR 2.0 genes in this pathway |
BOYLAN MULTIPLE MYELOMA C D DN | 252 | 155 | All SZGR 2.0 genes in this pathway |
GOLDRATH ANTIGEN RESPONSE | 346 | 192 | All SZGR 2.0 genes in this pathway |
YOSHIMURA MAPK8 TARGETS UP | 1305 | 895 | All SZGR 2.0 genes in this pathway |
WENDT COHESIN TARGETS UP | 33 | 19 | All SZGR 2.0 genes in this pathway |
COULOUARN TEMPORAL TGFB1 SIGNATURE DN | 138 | 99 | All SZGR 2.0 genes in this pathway |
YAMANAKA GLIOBLASTOMA SURVIVAL DN | 9 | 7 | All SZGR 2.0 genes in this pathway |
KUROKAWA LIVER CANCER EARLY RECURRENCE UP | 12 | 9 | All SZGR 2.0 genes in this pathway |
BOYLAN MULTIPLE MYELOMA PCA1 UP | 101 | 66 | All SZGR 2.0 genes in this pathway |
BOYLAN MULTIPLE MYELOMA PCA3 UP | 80 | 54 | All SZGR 2.0 genes in this pathway |
CAIRO HEPATOBLASTOMA UP | 207 | 143 | All SZGR 2.0 genes in this pathway |
ZHAN MULTIPLE MYELOMA PR DN | 44 | 34 | All SZGR 2.0 genes in this pathway |
WONG ADULT TISSUE STEM MODULE | 721 | 492 | All SZGR 2.0 genes in this pathway |
KARLSSON TGFB1 TARGETS DN | 207 | 139 | All SZGR 2.0 genes in this pathway |
KIM BIPOLAR DISORDER OLIGODENDROCYTE DENSITY CORR UP | 682 | 440 | All SZGR 2.0 genes in this pathway |
VERHAAK GLIOBLASTOMA PRONEURAL | 177 | 132 | All SZGR 2.0 genes in this pathway |
HIRSCH CELLULAR TRANSFORMATION SIGNATURE DN | 103 | 67 | All SZGR 2.0 genes in this pathway |
WANG RESPONSE TO GSK3 INHIBITOR SB216763 UP | 397 | 206 | All SZGR 2.0 genes in this pathway |
DUTERTRE ESTRADIOL RESPONSE 6HR DN | 91 | 56 | All SZGR 2.0 genes in this pathway |
DUTERTRE ESTRADIOL RESPONSE 24HR DN | 505 | 328 | All SZGR 2.0 genes in this pathway |
PILON KLF1 TARGETS UP | 504 | 321 | All SZGR 2.0 genes in this pathway |
JOHNSTONE PARVB TARGETS 2 DN | 336 | 211 | All SZGR 2.0 genes in this pathway |
ISSAEVA MLL2 TARGETS | 62 | 35 | All SZGR 2.0 genes in this pathway |
LEE BMP2 TARGETS UP | 745 | 475 | All SZGR 2.0 genes in this pathway |
KOINUMA TARGETS OF SMAD2 OR SMAD3 | 824 | 528 | All SZGR 2.0 genes in this pathway |
GOBERT OLIGODENDROCYTE DIFFERENTIATION DN | 1080 | 713 | All SZGR 2.0 genes in this pathway |
PLASARI TGFB1 TARGETS 1HR DN | 6 | 5 | All SZGR 2.0 genes in this pathway |
PHONG TNF RESPONSE VIA P38 PARTIAL | 160 | 106 | All SZGR 2.0 genes in this pathway |
LIM MAMMARY LUMINAL MATURE UP | 116 | 65 | All SZGR 2.0 genes in this pathway |
WARTERS RESPONSE TO IR SKIN | 83 | 44 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-124.1 | 900 | 907 | 1A,m8 | hsa-miR-124a | UUAAGGCACGCGGUGAAUGCCA |
miR-124/506 | 900 | 906 | 1A | hsa-miR-506 | UAAGGCACCCUUCUGAGUAGA |
hsa-miR-124brain | UAAGGCACGCGGUGAAUGCC | ||||
miR-142-5p | 1165 | 1172 | 1A,m8 | hsa-miR-142-5p | CAUAAAGUAGAAAGCACUAC |
miR-150 | 1969 | 1975 | 1A | hsa-miR-150 | UCUCCCAACCCUUGUACCAGUG |
miR-18 | 1057 | 1063 | m8 | hsa-miR-18a | UAAGGUGCAUCUAGUGCAGAUA |
hsa-miR-18b | UAAGGUGCAUCUAGUGCAGUUA | ||||
miR-192/215 | 227 | 233 | m8 | hsa-miR-192 | CUGACCUAUGAAUUGACAGCC |
hsa-miR-215 | AUGACCUAUGAAUUGACAGAC | ||||
miR-223 | 681 | 688 | 1A,m8 | hsa-miR-223 | UGUCAGUUUGUCAAAUACCCC |
miR-299-5p | 1758 | 1764 | 1A | hsa-miR-299-5p | UGGUUUACCGUCCCACAUACAU |
miR-34/449 | 897 | 903 | m8 | hsa-miR-34abrain | UGGCAGUGUCUUAGCUGGUUGUU |
hsa-miR-34c | AGGCAGUGUAGUUAGCUGAUUGC | ||||
hsa-miR-449 | UGGCAGUGUAUUGUUAGCUGGU | ||||
hsa-miR-449b | AGGCAGUGUAUUGUUAGCUGGC | ||||
miR-34b | 898 | 904 | m8 | hsa-miR-34b | UAGGCAGUGUCAUUAGCUGAUUG |
miR-376c | 1133 | 1140 | 1A,m8 | hsa-miR-376c | AACAUAGAGGAAAUUCCACG |
miR-409-3p | 1150 | 1156 | 1A | hsa-miR-409-3p | CGAAUGUUGCUCGGUGAACCCCU |
miR-495 | 1865 | 1871 | 1A | hsa-miR-495brain | AAACAAACAUGGUGCACUUCUUU |
hsa-miR-495brain | AAACAAACAUGGUGCACUUCUUU | ||||
miR-496 | 304 | 310 | 1A | hsa-miR-496 | AUUACAUGGCCAAUCUC |
hsa-miR-496 | AUUACAUGGCCAAUCUC | ||||
miR-9 | 1761 | 1767 | m8 | hsa-miR-9SZ | UCUUUGGUUAUCUAGCUGUAUGA |
hsa-miR-9SZ | UCUUUGGUUAUCUAGCUGUAUGA |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.