SZGR2

Summary ?

GeneID	2146
Symbol	EZH2
Synonyms	ENX-1\|ENX1\|EZH1\|EZH2b\|KMT6\|KMT6A\|WVS\|WVS2
Description	enhancer of zeste 2 polycomb repressive complex 2 subunit
Reference	MIM:601573\|HGNC:HGNC:3527\|Ensembl:ENSG00000106462\|HPRD:03342\|Vega:OTTHUMG00000158973
Gene type	protein-coding
Map location	7q35-q36
Pascal p-value	0.316
Sherlock p-value	0.811
Fetal beta	5.018
DMG	1 (# studies)
Support	Chromatin Remodeling Genes

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Wockner_2014	Genome-wide DNA methylation analysis	This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24).	1
Network	Shortest path distance of core genes in the Human protein-protein interaction network	Contribution to shortest path in PPI network: 0.0238

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg02303805	7	148582347	EZH2	5.479E-4	0.47	0.049	DMG:Wockner_2014

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
NPB	0.79	0.74
PRR7	0.78	0.80
CNIH2	0.74	0.75
CPNE2	0.71	0.67
B9D2	0.70	0.71
RP11-544M22.1	0.70	0.75
LY6H	0.70	0.76
EPCAM	0.70	0.65
AC100793.2	0.69	0.63
DUSP23	0.68	0.66

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
AF347015.2	-0.42	-0.46
MT-CO2	-0.42	-0.44
AF347015.8	-0.41	-0.45
AF347015.15	-0.40	-0.44
AF347015.26	-0.40	-0.46
AF347015.27	-0.39	-0.43
AF347015.33	-0.39	-0.42
MT-CYB	-0.39	-0.43
MT-ATP8	-0.38	-0.47
AF347015.31	-0.38	-0.41

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0003677	DNA binding	TAS		8954776
GO:0005515	protein binding	IPI		16357870 \|17560333
GO:0016740	transferase activity	IEA		-
GO:0008168	methyltransferase activity	IEA		-
GO:0018024	histone-lysine N-methyltransferase activity	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0006355	regulation of transcription, DNA-dependent	TAS		8921387
GO:0006350	transcription	IEA		-
GO:0016568	chromatin modification	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005634	nucleus	IEA		-
GO:0035098	ESC/E(Z) complex	IDA		15385962

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
ATP1A1	MGC3285 \| MGC51750	ATPase, Na+/K+ transporting, alpha 1 polypeptide	Two-hybrid	BioGRID	16169070
ATRX	ATR2 \| MGC2094 \| MRXHF1 \| RAD54 \| RAD54L \| SFM1 \| SHS \| XH2 \| XNP \| ZNF-HX	alpha thalassemia/mental retardation syndrome X-linked (RAD54 homolog, S. cerevisiae)	-	HPRD,BioGRID	9499421
CCDC85B	DIPA	coiled-coil domain containing 85B	Two-hybrid	BioGRID	16189514
E2F6	E2F-6 \| MGC111545	E2F transcription factor 6	-	HPRD	15536069
EED	HEED \| WAIT1	embryonic ectoderm development	Affinity Capture-Western Co-fractionation Reconstituted Complex Two-hybrid	BioGRID	9584197 \|9742080 \|10581039
EED	HEED \| WAIT1	embryonic ectoderm development	-	HPRD	9584197\|10581039
EED	HEED \| WAIT1	embryonic ectoderm development	EZH2 interacts with EED.	BIND	15225548
GTF3C1	DKFZp686A111 \| TFIIIC \| TFIIIC220 \| TFIIICalpha	general transcription factor IIIC, polypeptide 1, alpha 220kDa	Two-hybrid	BioGRID	16169070
HDAC1	DKFZp686H12203 \| GON-10 \| HD1 \| RPD3 \| RPD3L1	histone deacetylase 1	-	HPRD,BioGRID	10581039
HDAC2	RPD3 \| YAF1	histone deacetylase 2	Affinity Capture-Western	BioGRID	10581039
KLHDC2	HCLP-1 \| LCP	kelch domain containing 2	Two-hybrid	BioGRID	16169070
PHF1	MTF2L2 \| PCL1 \| PHF2	PHD finger protein 1	-	HPRD,BioGRID	11571280
PIN4	EPVH \| MGC138486 \| PAR14 \| PAR17	protein (peptidylprolyl cis/trans isomerase) NIMA-interacting, 4 (parvulin)	Two-hybrid	BioGRID	16169070
POLA2	FLJ21662 \| FLJ37250	polymerase (DNA directed), alpha 2 (70kD subunit)	Two-hybrid	BioGRID	16169070
PSMB6	DELTA \| LMPY \| MGC5169 \| Y	proteasome (prosome, macropain) subunit, beta type, 6	Two-hybrid	BioGRID	16169070
RP4-691N24.1	FLJ11792 \| KIAA0980 \| NLP \| dJ691N24.1	ninein-like	Two-hybrid	BioGRID	16169070
RPN2	RIBIIR \| RPN-II \| RPNII \| SWP1	ribophorin II	Two-hybrid	BioGRID	16169070
VAV1	VAV	vav 1 guanine nucleotide exchange factor	-	HPRD,BioGRID	8649418 \|10780782
WDR61	REC14 \| SKI8	WD repeat domain 61	Two-hybrid	BioGRID	16169070
WSB2	MGC10210 \| SBA2	WD repeat and SOCS box-containing 2	Two-hybrid	BioGRID	16169070
YY1	DELTA \| INO80S \| NF-E1 \| UCRBP \| YIN-YANG-1	YY1 transcription factor	EED interacts with EZH2.	BIND	14610174

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
PYEON HPV POSITIVE TUMORS UP	98	47	All SZGR 2.0 genes in this pathway
SENGUPTA NASOPHARYNGEAL CARCINOMA UP	294	178	All SZGR 2.0 genes in this pathway
SOTIRIOU BREAST CANCER GRADE 1 VS 3 UP	151	84	All SZGR 2.0 genes in this pathway
LIU CMYB TARGETS UP	165	106	All SZGR 2.0 genes in this pathway
LIU VMYB TARGETS UP	127	78	All SZGR 2.0 genes in this pathway
VECCHI GASTRIC CANCER EARLY UP	430	232	All SZGR 2.0 genes in this pathway
SLEBOS HEAD AND NECK CANCER WITH HPV UP	84	43	All SZGR 2.0 genes in this pathway
GRAHAM CML QUIESCENT VS NORMAL QUIESCENT UP	87	45	All SZGR 2.0 genes in this pathway
GRAHAM CML DIVIDING VS NORMAL QUIESCENT UP	181	101	All SZGR 2.0 genes in this pathway
DODD NASOPHARYNGEAL CARCINOMA DN	1375	806	All SZGR 2.0 genes in this pathway
HAHTOLA SEZARY SYNDROM UP	98	58	All SZGR 2.0 genes in this pathway
PROVENZANI METASTASIS UP	194	112	All SZGR 2.0 genes in this pathway
LINDGREN BLADDER CANCER CLUSTER 1 DN	378	231	All SZGR 2.0 genes in this pathway
LINDGREN BLADDER CANCER CLUSTER 3 UP	329	196	All SZGR 2.0 genes in this pathway
MARKEY RB1 CHRONIC LOF UP	115	78	All SZGR 2.0 genes in this pathway
BERENJENO TRANSFORMED BY RHOA UP	536	340	All SZGR 2.0 genes in this pathway
MISSIAGLIA REGULATED BY METHYLATION DN	122	67	All SZGR 2.0 genes in this pathway
TANG SENESCENCE TP53 TARGETS DN	57	33	All SZGR 2.0 genes in this pathway
KONG E2F3 TARGETS	97	58	All SZGR 2.0 genes in this pathway
RIZ ERYTHROID DIFFERENTIATION	77	51	All SZGR 2.0 genes in this pathway
ROSTY CERVICAL CANCER PROLIFERATION CLUSTER	140	73	All SZGR 2.0 genes in this pathway
PATIL LIVER CANCER	747	453	All SZGR 2.0 genes in this pathway
LI WILMS TUMOR VS FETAL KIDNEY 2 UP	30	24	All SZGR 2.0 genes in this pathway
SPIELMAN LYMPHOBLAST EUROPEAN VS ASIAN UP	479	299	All SZGR 2.0 genes in this pathway
PUJANA XPRSS INT NETWORK	168	103	All SZGR 2.0 genes in this pathway
PUJANA BRCA1 PCC NETWORK	1652	1023	All SZGR 2.0 genes in this pathway
PUJANA BRCA2 PCC NETWORK	423	265	All SZGR 2.0 genes in this pathway
PUJANA ATM PCC NETWORK	1442	892	All SZGR 2.0 genes in this pathway
PUJANA CHEK2 PCC NETWORK	779	480	All SZGR 2.0 genes in this pathway
PUJANA BRCA CENTERED NETWORK	117	72	All SZGR 2.0 genes in this pathway
NUYTTEN EZH2 TARGETS DN	1024	594	All SZGR 2.0 genes in this pathway
LIAO METASTASIS	539	324	All SZGR 2.0 genes in this pathway
PASQUALUCCI LYMPHOMA BY GC STAGE DN	165	104	All SZGR 2.0 genes in this pathway
BENPORATH PROLIFERATION	147	80	All SZGR 2.0 genes in this pathway
BENPORATH ES CORE NINE CORRELATED	100	68	All SZGR 2.0 genes in this pathway
MORI IMMATURE B LYMPHOCYTE DN	90	55	All SZGR 2.0 genes in this pathway
MORI MATURE B LYMPHOCYTE DN	75	43	All SZGR 2.0 genes in this pathway
PARK HSC VS MULTIPOTENT PROGENITORS DN	18	12	All SZGR 2.0 genes in this pathway
VANTVEER BREAST CANCER METASTASIS DN	121	65	All SZGR 2.0 genes in this pathway
TARTE PLASMA CELL VS PLASMABLAST DN	309	206	All SZGR 2.0 genes in this pathway
LE EGR2 TARGETS UP	108	75	All SZGR 2.0 genes in this pathway
ZHAN MULTIPLE MYELOMA SUBGROUPS	30	20	All SZGR 2.0 genes in this pathway
MOREAUX B LYMPHOCYTE MATURATION BY TACI DN	73	45	All SZGR 2.0 genes in this pathway
LEI MYB TARGETS	318	215	All SZGR 2.0 genes in this pathway
LI WILMS TUMOR VS FETAL KIDNEY 1 DN	163	115	All SZGR 2.0 genes in this pathway
ZHAN MULTIPLE MYELOMA PR UP	45	20	All SZGR 2.0 genes in this pathway
STAEGE EWING FAMILY TUMOR	33	22	All SZGR 2.0 genes in this pathway
VERNELL RETINOBLASTOMA PATHWAY UP	70	47	All SZGR 2.0 genes in this pathway
ZHAN V2 LATE DIFFERENTIATION GENES	45	34	All SZGR 2.0 genes in this pathway
MOREAUX MULTIPLE MYELOMA BY TACI DN	172	107	All SZGR 2.0 genes in this pathway
SU TESTIS	76	53	All SZGR 2.0 genes in this pathway
KAAB HEART ATRIUM VS VENTRICLE UP	249	170	All SZGR 2.0 genes in this pathway
RHODES UNDIFFERENTIATED CANCER	69	44	All SZGR 2.0 genes in this pathway
BURTON ADIPOGENESIS 3	101	64	All SZGR 2.0 genes in this pathway
SONG TARGETS OF IE86 CMV PROTEIN	60	42	All SZGR 2.0 genes in this pathway
LIANG SILENCED BY METHYLATION DN	11	7	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 6HR UP	71	48	All SZGR 2.0 genes in this pathway
BANDRES RESPONSE TO CARMUSTIN MGMT 48HR DN	161	105	All SZGR 2.0 genes in this pathway
BILD E2F3 ONCOGENIC SIGNATURE	246	153	All SZGR 2.0 genes in this pathway
MARSON BOUND BY E2F4 UNSTIMULATED	728	415	All SZGR 2.0 genes in this pathway
GAZIN EPIGENETIC SILENCING BY KRAS	26	16	All SZGR 2.0 genes in this pathway
OUYANG PROSTATE CANCER MARKERS	19	16	All SZGR 2.0 genes in this pathway
RIGGI EWING SARCOMA PROGENITOR UP	430	288	All SZGR 2.0 genes in this pathway
ZHANG BREAST CANCER PROGENITORS UP	425	253	All SZGR 2.0 genes in this pathway
GRADE COLON CANCER UP	871	505	All SZGR 2.0 genes in this pathway
WEST ADRENOCORTICAL TUMOR UP	294	199	All SZGR 2.0 genes in this pathway
LU TUMOR ANGIOGENESIS UP	25	22	All SZGR 2.0 genes in this pathway
BLUM RESPONSE TO SALIRASIB DN	342	220	All SZGR 2.0 genes in this pathway
WANG TUMOR INVASIVENESS UP	374	247	All SZGR 2.0 genes in this pathway
GOLDRATH ANTIGEN RESPONSE	346	192	All SZGR 2.0 genes in this pathway
CHANG CYCLING GENES	148	83	All SZGR 2.0 genes in this pathway
MUELLER COMMON TARGETS OF AML FUSIONS DN	31	21	All SZGR 2.0 genes in this pathway
HOFFMANN SMALL PRE BII TO IMMATURE B LYMPHOCYTE DN	50	33	All SZGR 2.0 genes in this pathway
SHEDDEN LUNG CANCER POOR SURVIVAL A6	456	285	All SZGR 2.0 genes in this pathway
ZHANG TLX TARGETS 36HR DN	185	116	All SZGR 2.0 genes in this pathway
ZHANG TLX TARGETS 60HR DN	277	166	All SZGR 2.0 genes in this pathway
ZHANG TLX TARGETS DN	89	50	All SZGR 2.0 genes in this pathway
CROONQUIST NRAS VS STROMAL STIMULATION DN	99	65	All SZGR 2.0 genes in this pathway
ISHIDA E2F TARGETS	53	27	All SZGR 2.0 genes in this pathway
BOYAULT LIVER CANCER SUBCLASS G3 UP	188	121	All SZGR 2.0 genes in this pathway
CHIANG LIVER CANCER SUBCLASS PROLIFERATION UP	178	108	All SZGR 2.0 genes in this pathway
PUJANA BREAST CANCER WITH BRCA1 MUTATED UP	56	27	All SZGR 2.0 genes in this pathway
KOBAYASHI EGFR SIGNALING 24HR DN	251	151	All SZGR 2.0 genes in this pathway
PYEON CANCER HEAD AND NECK VS CERVICAL UP	193	95	All SZGR 2.0 genes in this pathway
CAIRO HEPATOBLASTOMA CLASSES UP	605	377	All SZGR 2.0 genes in this pathway
KAMMINGA SENESCENCE	41	26	All SZGR 2.0 genes in this pathway
WHITFIELD CELL CYCLE S	162	86	All SZGR 2.0 genes in this pathway
CHICAS RB1 TARGETS SENESCENT	572	352	All SZGR 2.0 genes in this pathway
CHICAS RB1 TARGETS GROWING	243	155	All SZGR 2.0 genes in this pathway
LU EZH2 TARGETS DN	414	237	All SZGR 2.0 genes in this pathway
PILON KLF1 TARGETS DN	1972	1213	All SZGR 2.0 genes in this pathway
JOHNSTONE PARVB TARGETS 3 DN	918	550	All SZGR 2.0 genes in this pathway
BRUINS UVC RESPONSE LATE	1137	655	All SZGR 2.0 genes in this pathway
MIYAGAWA TARGETS OF EWSR1 ETS FUSIONS UP	259	159	All SZGR 2.0 genes in this pathway
LEE BMP2 TARGETS DN	882	538	All SZGR 2.0 genes in this pathway
FEVR CTNNB1 TARGETS DN	553	343	All SZGR 2.0 genes in this pathway
GOBERT OLIGODENDROCYTE DIFFERENTIATION UP	570	339	All SZGR 2.0 genes in this pathway
PEDERSEN METASTASIS BY ERBB2 ISOFORM 7	403	240	All SZGR 2.0 genes in this pathway
WAKABAYASHI ADIPOGENESIS PPARG BOUND 8D	658	397	All SZGR 2.0 genes in this pathway
RAO BOUND BY SALL4 ISOFORM B	517	302	All SZGR 2.0 genes in this pathway
ZHOU CELL CYCLE GENES IN IR RESPONSE 6HR	85	49	All SZGR 2.0 genes in this pathway
ZHOU CELL CYCLE GENES IN IR RESPONSE 24HR	128	73	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
let-7/98	7	13	m8	hsa-let-7a^brain	UGAGGUAGUAGGUUGUAUAGUU
				hsa-let-7b^brain	UGAGGUAGUAGGUUGUGUGGUU
				hsa-let-7c^brain	UGAGGUAGUAGGUUGUAUGGUU
				hsa-let-7d^brain	AGAGGUAGUAGGUUGCAUAGU
				hsa-let-7e^brain	UGAGGUAGGAGGUUGUAUAGU
				hsa-let-7f^brain	UGAGGUAGUAGAUUGUAUAGUU
				hsa-miR-98^brain	UGAGGUAGUAAGUUGUAUUGUU
				hsa-let-7g^SZ	UGAGGUAGUAGUUUGUACAGU
				hsa-let-7i^brain	UGAGGUAGUAGUUUGUGCUGU
miR-101	59	65	m8	hsa-miR-101	UACAGUACUGUGAUAACUGAAG
miR-101	59	65	m8	hsa-miR-101	UACAGUACUGUGAUAACUGAAG
miR-124.1	36	42	m8	hsa-miR-124a	UUAAGGCACGCGGUGAAUGCCA
miR-124/506	36	42	1A	hsa-miR-506	UAAGGCACCCUUCUGAGUAGA
miR-124/506	36	42	1A	hsa-miR-124^brain	UAAGGCACGCGGUGAAUGCC
miR-138	171	177	m8	hsa-miR-138^brain	AGCUGGUGUUGUGAAUC
miR-144	115	121	1A	hsa-miR-144	UACAGUAUAGAUGAUGUACUAG
miR-217	86	92	m8	hsa-miR-217	UACUGCAUCAGGAACUGAUUGGAU
miR-217	86	92	m8	hsa-miR-217	UACUGCAUCAGGAACUGAUUGGAU
miR-25/32/92/363/367	206	212	1A	hsa-miR-25^brain	CAUUGCACUUGUCUCGGUCUGA
				hsa-miR-32	UAUUGCACAUUACUAAGUUGC
				hsa-miR-92	UAUUGCACUUGUCCCGGCCUG
				hsa-miR-367	AAUUGCACUUUAGCAAUGGUGA
				hsa-miR-92b^SZ	UAUUGCACUCGUCCCGGCCUC
miR-26	250	257	1A,m8	hsa-miR-26a^brain	UUCAAGUAAUCCAGGAUAGGC
miR-26	250	257	1A,m8	hsa-miR-26b^SZ	UUCAAGUAAUUCAGGAUAGGUU
miR-378	46	52	1A	hsa-miR-378	CUCCUGACUCCAGGUCCUGUGU

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: EZH2