Gene Page: AMER2
Summary ?
| GeneID | 219287 |
| Symbol | AMER2 |
| Synonyms | FAM123A |
| Description | APC membrane recruitment protein 2 |
| Reference | MIM:614659|HGNC:HGNC:26360|Ensembl:ENSG00000165566|HPRD:08067|Vega:OTTHUMG00000016602 |
| Gene type | protein-coding |
| Map location | 13q12.13 |
| Pascal p-value | 0.165 |
| DEG p-value | DEG:Zhao_2015:p=5.38e-06:q=0.0257 |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| DEG:Zhao_2015 | RNA Sequencing analysis | Transcriptome sequencing and genome-wide association analyses reveal lysosomal function and actin cytoskeleton remodeling in schizophrenia and bipolar disorder. |
Section I. Genetics and epigenetics annotation
eQTL annotation
| SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
|---|---|---|---|---|---|---|---|---|
| rs17142759 | chr10 | 7581464 | FAM123A | 219287 | 0.19 | trans | ||
| rs11076856 | chr16 | 4949814 | FAM123A | 219287 | 0.01 | trans | ||
| rs6098023 | chr20 | 53113740 | FAM123A | 219287 | 0.02 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0005515 | protein binding | IEA | - |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-125/351 | 789 | 795 | 1A | hsa-miR-125bbrain | UCCCUGAGACCCUAACUUGUGA |
| hsa-miR-125abrain | UCCCUGAGACCCUUUAACCUGUG | ||||
| miR-128 | 527 | 533 | m8 | hsa-miR-128a | UCACAGUGAACCGGUCUCUUUU |
| hsa-miR-128b | UCACAGUGAACCGGUCUCUUUC | ||||
| miR-140 | 57 | 63 | m8 | hsa-miR-140brain | AGUGGUUUUACCCUAUGGUAG |
| miR-153 | 631 | 637 | 1A | hsa-miR-153 | UUGCAUAGUCACAAAAGUGA |
| miR-448 | 630 | 637 | 1A,m8 | hsa-miR-448 | UUGCAUAUGUAGGAUGUCCCAU |
| miR-544 | 327 | 334 | 1A,m8 | hsa-miR-544 | AUUCUGCAUUUUUAGCAAGU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.