SZGR2

Summary ?

GeneID	219541
Symbol	MED19
Synonyms	DT2P1G7\|LCMR1\|MED19AS
Description	mediator complex subunit 19
Reference	MIM:612385\|HGNC:HGNC:29600\|Ensembl:ENSG00000156603\|HPRD:17477\|Vega:OTTHUMG00000167199
Gene type	protein-coding
Map location	11q12.1
Pascal p-value	3.987E-7
Sherlock p-value	0.196
Fetal beta	0.499
DMG	1 (# studies)

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Nishioka_2013	Genome-wide DNA methylation analysis	The authors investigated the methylation profiles of DNA in peripheral blood cells from 18 patients with first-episode schizophrenia (FESZ) and from 15 normal controls.	1
Network	Shortest path distance of core genes in the Human protein-protein interaction network	Contribution to shortest path in PPI network: 0.034

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg27497687	11	57479637	MED19		-0.026	0.25	DMG:Nishioka_2013

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005515	protein binding	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0006355	regulation of transcription, DNA-dependent	IEA		-
GO:0006350	transcription	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0000119	mediator complex	IEA		-
GO:0005634	nucleus	IEA		-

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
CCNC	CycC	cyclin C	Affinity Capture-MS	BioGRID	15175163
CDC2L6	CDK11 \| KIAA1028 \| bA346C16.3	cell division cycle 2-like 6 (CDK8-like)	Affinity Capture-MS	BioGRID	15175163
CDK8	K35 \| MGC126074 \| MGC126075	cyclin-dependent kinase 8	Affinity Capture-MS	BioGRID	15175163
DCK	MGC117410 \| MGC138632	deoxycytidine kinase	Two-hybrid	BioGRID	16169070
MED1	CRSP1 \| CRSP200 \| DRIP205 \| DRIP230 \| MGC71488 \| PBP \| PPARBP \| PPARGBP \| RB18A \| TRAP220 \| TRIP2	mediator complex subunit 1	Affinity Capture-MS Affinity Capture-Western	BioGRID	14638676 \|15175163
MED10	L6 \| MGC5309 \| NUT2 \| TRG20	mediator complex subunit 10	Affinity Capture-MS Affinity Capture-Western	BioGRID	12584197 \|14638676 \|15175163
MED11	HSPC296 \| MGC88387	mediator complex subunit 11	Affinity Capture-MS Affinity Capture-Western	BioGRID	14576168 \|14638676 \|15175163
MED12	CAGH45 \| HOPA \| KIAA0192 \| OPA1 \| TNRC11 \| TRAP230	mediator complex subunit 12	Affinity Capture-MS	BioGRID	15175163
MED13	ARC250 \| DRIP250 \| HSPC221 \| KIAA0593 \| THRAP1 \| TRAP240	mediator complex subunit 13	Affinity Capture-MS	BioGRID	15175163
MED13L	DKFZp781D0112 \| FLJ21627 \| KIAA1025 \| PROSIT240 \| THRAP2 \| TRAP240L	mediator complex subunit 13-like	Affinity Capture-MS	BioGRID	15175163
MED14	CRSP150 \| CRSP2 \| CSRP \| CXorf4 \| DRIP150 \| EXLM1 \| MGC104513 \| RGR1 \| TRAP170	mediator complex subunit 14	Affinity Capture-MS	BioGRID	15175163
MED15	ARC105 \| CAG7A \| CTG7A \| DKFZp686A2214 \| DKFZp762B1216 \| FLJ42282 \| FLJ42935 \| PCQAP \| TIG-1 \| TIG1 \| TNRC7	mediator complex subunit 15	Affinity Capture-MS	BioGRID	15175163
MED16	DRIP92 \| THRAP5 \| TRAP95	mediator complex subunit 16	Affinity Capture-MS	BioGRID	15175163
MED17	CRSP6 \| CRSP77 \| DRIP80 \| FLJ10812 \| TRAP80	mediator complex subunit 17	Affinity Capture-MS Affinity Capture-Western Reconstituted Complex	BioGRID	12584197 \|14576168 \|14638676 \|15175163
MED17	CRSP6 \| CRSP77 \| DRIP80 \| FLJ10812 \| TRAP80	mediator complex subunit 17	TRAP80 interacts with LCMR1. This interaction was modelled on a demonstrated interaction between human TRAP80 and mouse LCMR1.	BIND	12584197
MED18	FLJ20045 \| p28b	mediator complex subunit 18	Affinity Capture-MS Affinity Capture-Western	BioGRID	14576168 \|14638676 \|15175163
MED19	DT2P1G7 \| LCMR1	mediator complex subunit 19	Affinity Capture-MS Affinity Capture-Western	BioGRID	14638676 \|15175163
MED20	DKFZp586D2223 \| MGC29869 \| PRO0213 \| TRFP	mediator complex subunit 20	Affinity Capture-MS Affinity Capture-Western	BioGRID	14576168 \|15175163
MED21	SRB7 \| SURB7	mediator complex subunit 21	Affinity Capture-MS	BioGRID	15175163
MED22	MED24 \| MGC48682 \| SURF5	mediator complex subunit 22	Affinity Capture-MS	BioGRID	15175163
MED23	CRSP130 \| CRSP133 \| CRSP3 \| DKFZp434H0117 \| DRIP130 \| SUR2	mediator complex subunit 23	Affinity Capture-MS	BioGRID	15175163
MED24	ARC100 \| CRSP100 \| CRSP4 \| DRIP100 \| KIAA0130 \| MGC8748 \| THRAP4 \| TRAP100	mediator complex subunit 24	Affinity Capture-MS	BioGRID	15175163
MED25	ACID1 \| ARC92 \| DKFZp434K0512 \| MGC70671 \| P78 \| PTOV2 \| TCBAP0758	mediator complex subunit 25	Affinity Capture-MS Affinity Capture-Western	BioGRID	14638676 \|15175163
MED26	CRSP7 \| CRSP70	mediator complex subunit 26	Affinity Capture-MS	BioGRID	15175163
MED27	CRAP34 \| CRSP34 \| CRSP8 \| MGC11274 \| TRAP37	mediator complex subunit 27	TRAP37 interacts with LCMR1. This interaction was modelled on a demonstrated interaction between human TRAP37 and mouse LCMR1.	BIND	12584197
MED27	CRAP34 \| CRSP34 \| CRSP8 \| MGC11274 \| TRAP37	mediator complex subunit 27	Affinity Capture-MS Reconstituted Complex	BioGRID	12584197 \|15175163
MED28	1500003D12Rik \| DKFZp434N185 \| EG1 \| magicin	mediator complex subunit 28	-	HPRD,BioGRID	15175163
MED29	DKFZp434H247 \| IXL	mediator complex subunit 29	-	HPRD,BioGRID	14576168
MED30	MGC9890 \| THRAP6 \| TRAP25	mediator complex subunit 30	Affinity Capture-MS	BioGRID	15175163
MED31	3110004H13Rik \| CGI-125 \| FLJ27436 \| FLJ36714 \| Soh1	mediator complex subunit 31	-	HPRD,BioGRID	12584197
MED4	DRIP36 \| FLJ10956 \| HSPC126 \| RP11-90M2.2 \| TRAP36 \| VDRIP	mediator complex subunit 4	Affinity Capture-MS Affinity Capture-Western	BioGRID	14638676 \|15175163
MED6	NY-REN-28	mediator complex subunit 6	Affinity Capture-MS Affinity Capture-Western	BioGRID	14576168 \|15175163
MED7	CRSP33 \| CRSP9 \| MGC12284	mediator complex subunit 7	Affinity Capture-MS	BioGRID	15175163
MED8	ARC32 \| MGC17544 \| MGC19641	mediator complex subunit 8	Affinity Capture-MS Affinity Capture-Western	BioGRID	14576168 \|14638676 \|15175163
MED9	FLJ10193 \| MED25 \| MGC138234	mediator complex subunit 9	Affinity Capture-MS	BioGRID	15175163
MED9	FLJ10193 \| MED25 \| MGC138234	mediator complex subunit 9	-	HPRD	14638676
NFKBIA	IKBA \| MAD-3 \| NFKBI	nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha	Two-hybrid	BioGRID	16169070
POLR2A	MGC75453 \| POLR2 \| POLRA \| RPB1 \| RPBh1 \| RPO2 \| RPOL2 \| RpIILS \| hRPB220 \| hsRPB1	polymerase (RNA) II (DNA directed) polypeptide A, 220kDa	Affinity Capture-MS	BioGRID	15175163
POLR2B	POL2RB \| RPB2 \| hRPB140 \| hsRPB2	polymerase (RNA) II (DNA directed) polypeptide B, 140kDa	Affinity Capture-MS	BioGRID	15175163
POLR2C	RPB3 \| RPB31 \| hRPB33 \| hsRPB3	polymerase (RNA) II (DNA directed) polypeptide C, 33kDa	Affinity Capture-MS	BioGRID	15175163
POLR2D	HSRBP4 \| HSRPB4 \| RBP4	polymerase (RNA) II (DNA directed) polypeptide D	Affinity Capture-MS	BioGRID	15175163
POLR2E	RPABC1 \| RPB5 \| XAP4 \| hRPB25 \| hsRPB5	polymerase (RNA) II (DNA directed) polypeptide E, 25kDa	Affinity Capture-MS	BioGRID	15175163
POLR2F	HRBP14.4 \| POLRF \| RPABC2 \| RPB14.4 \| RPB6	polymerase (RNA) II (DNA directed) polypeptide F	Affinity Capture-MS	BioGRID	15175163
POLR2G	MGC138367 \| MGC138369 \| RPB7 \| hRPB19 \| hsRPB7	polymerase (RNA) II (DNA directed) polypeptide G	Affinity Capture-MS	BioGRID	15175163
POLR2H	RPABC3 \| RPB17 \| RPB8 \| hsRPB8	polymerase (RNA) II (DNA directed) polypeptide H	Affinity Capture-MS	BioGRID	15175163
POLR2I	RPB9 \| hRPB14.5	polymerase (RNA) II (DNA directed) polypeptide I, 14.5kDa	Affinity Capture-MS	BioGRID	15175163
POLR2J	MGC71910 \| POLR2J1 \| RPB11 \| RPB11A \| RPB11m \| hRPB14	polymerase (RNA) II (DNA directed) polypeptide J, 13.3kDa	Affinity Capture-MS	BioGRID	15175163
POLR2L	RBP10 \| RPABC5 \| RPB10 \| RPB10beta \| RPB7.6 \| hRPB7.6 \| hsRPB10b	polymerase (RNA) II (DNA directed) polypeptide L, 7.6kDa	Affinity Capture-MS	BioGRID	15175163
RADIL	FLJ10324 \| KIAA1849 \| MGC161589	Rap GTPase interactor	Two-hybrid	BioGRID	16169070
TFF1	BCEI \| D21S21 \| HP1.A \| HPS2 \| pNR-2 \| pS2	trefoil factor 1	MED19 interacts with pS2 promoter.	BIND	15989967

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
REACTOME DEVELOPMENTAL BIOLOGY	396	292	All SZGR 2.0 genes in this pathway
REACTOME PPARA ACTIVATES GENE EXPRESSION	104	72	All SZGR 2.0 genes in this pathway
REACTOME METABOLISM OF LIPIDS AND LIPOPROTEINS	478	302	All SZGR 2.0 genes in this pathway
REACTOME FATTY ACID TRIACYLGLYCEROL AND KETONE BODY METABOLISM	168	115	All SZGR 2.0 genes in this pathway
REACTOME TRANSCRIPTIONAL REGULATION OF WHITE ADIPOCYTE DIFFERENTIATION	72	53	All SZGR 2.0 genes in this pathway
OSMAN BLADDER CANCER UP	404	246	All SZGR 2.0 genes in this pathway
SHETH LIVER CANCER VS TXNIP LOSS PAM6	46	32	All SZGR 2.0 genes in this pathway
JOHNSTONE PARVB TARGETS 3 DN	918	550	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-214	633	640	1A,m8	hsa-miR-214^brain	ACAGCAGGCACAGACAGGCAG

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: MED19